Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5773
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lawrence, D.; Stover, C.; Noznitsky, J.; Wu, Z.; Summers, M.. "Structure of the Intact Stem and Bulge of HIV-1 Psi-RNA Stem Loop SL1" J. Mol. Biol. 326, 529-542 (2003).
PubMed: 12559920
Assembly members:
HIV-1 Stem loop SL1, polymer, 36 residues, 12363 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV-1 Stem loop SL1: GGACUCGGCUUGCUGGAGAC
GGCAAGAGGCGAGUCC
Data type | Count |
13C chemical shifts | 237 |
1H chemical shifts | 272 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | HIV-1 STEM LOOP SL1 MONOMERIC RNA | 1 |
Entity 1, HIV-1 STEM LOOP SL1 MONOMERIC RNA 36 residues - 12363 Da.
1 | G | G | A | C | U | C | G | G | C | U | ||||
2 | U | G | C | U | G | G | A | G | A | C | ||||
3 | G | G | C | A | A | G | A | G | G | C | ||||
4 | G | A | G | U | C | C |
sample_1: HIV-1 Stem loop SL1, [U-13C; U-15N], 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 100%
sample_2: HIV-1 Stem loop SL1, [13C, 15N]-cytidine, 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 100%
sample_3: HIV-1 Stem loop SL1 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 100%
sample_4: HIV-1 Stem loop SL1, [U-13C; U-15N], 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; Pf1 phage 17 mg/ml
sample_5: HIV-1 Stem loop SL1 1.0 mM; Tris-Cl 10 mM; Na-EDTA 0.1 mM; D2O 10%; H2O 90%
sample_cond_1: pH: 6.0; pressure: 1 atm; temperature: 308 K
sample_cond_2: pH: 8.0; pressure: 1 atm; temperature: 308 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
3D 13C-separated NOESY | not available | not available | not available |
4D 13C-separated NOESY | not available | not available | not available |
3D 13C-separated ROESY | not available | not available | not available |
IPAP H-COUPLED CT-HSQC | not available | not available | not available |
2D NOESY | not available | not available | not available |
2D ROESY | not available | not available | not available |
xwinnmr v2.6 - collection
NMRPipe v2.1 - processing
NMRView v5.0.3 - data analysis
DYANA v1.5 - refinement