Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51955
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Korn, Sophie; Dhamotharan, Karthikeyan; Jeffries, Cy; Schlundt, Andreas. "The preference signature of the SARS-CoV-2 Nucleocapsid NTD for its 5'-genomic RNA elements
" Nat. Commun. 14, 3331-3331 (2023).
PubMed: 37286558
Assembly members:
entity_1, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGAUAAUUAAUAACUAAUUA
CU
| Data type | Count |
| 1H chemical shifts | 6 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Ext | 1 |
Entity 1, Ext 22 residues - Formula weight is not available
G127 and G128 are artificial (G1 and G2), the natural sequence (Wuhan type) starts with A129, which is A3 in this isolated construct
| 1 | G | G | A | U | A | A | U | U | A | A | ||||
| 2 | U | A | A | C | U | A | A | U | U | A | ||||
| 3 | C | U |
sample_1: Ext 300 ± 15 uM; potassium phosphate 25 ± 0.25 mM; potassium chloride 150 ± 1.5 mM
sample_conditions_1: ionic strength: 150 mM; pH: 6.5; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1D 1H | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN vv3, v4 - chemical shift assignment, collection, data analysis
ANALYSIS vv2.4 - chemical shift assignment, data analysis