Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25996
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Imai, Shunsuke; Hellen, Christopher; D'Souza, Victoria; Wagner, Gerhard. "An accurately preorganized IRES RNA structure enables eIF4G capture for initiation of viral translation" Nat. Struct. Mol. Biol. 23, 859-864 (2016).
PubMed: 27525590
Assembly members:
RNA_(108-MER), polymer, 108 residues, 34838.840 Da.
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus Cardiovirus A
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
RNA_(108-MER): GGGGCUGAAGGAUGCCCAGA
AGGUACCCCAUUGUAUGGGA
UCUGAUCUGGGGCCUCGGUG
CACAUGCUUUACAUGUGUUU
AGUCGAGGUUAAAAAACGUC
UAGGCCCC
| Data type | Count |
| 1H chemical shifts | 90 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | RNA (108-MER) | 1 |
Entity 1, RNA (108-MER) 108 residues - 34838.840 Da.
| 1 | G | G | G | G | C | U | G | A | A | G | ||||
| 2 | G | A | U | G | C | C | C | A | G | A | ||||
| 3 | A | G | G | U | A | C | C | C | C | A | ||||
| 4 | U | U | G | U | A | U | G | G | G | A | ||||
| 5 | U | C | U | G | A | U | C | U | G | G | ||||
| 6 | G | G | C | C | U | C | G | G | U | G | ||||
| 7 | C | A | C | A | U | G | C | U | U | U | ||||
| 8 | A | C | A | U | G | U | G | U | U | U | ||||
| 9 | A | G | U | C | G | A | G | G | U | U | ||||
| 10 | A | A | A | A | A | A | C | G | U | C | ||||
| 11 | U | A | G | G | C | C | C | C |
sample_1: RNA (108-MER) 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%
sample_2: RNA (108-MER), [U-2H, {H1',H2',H2,H8}-Ade], 0.5 mM; potassium phosphate 10 mM; sodium chloride 10 mM; D2O, [U-2H], 100%
sample_conditions_1: ionic strength: 20 mM; pH: 6.5; pressure: 1 atm; temperature: 308 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
CARA, Keller and Wuthrich - chemical shift assignment
CYANA, Guntert, Mumenthaler and Wuthrich - structure solution
X-PLOR_NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement