Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR51906
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Imai, Shunsuke; Suzuki, Hiroshi; Fujiyoshi, Yoshinori; Shimada, Ichio. "Dynamically regulated two-site interaction of viral RNA to capture host translation initiation factor" Nat. Commun. 14, 4977-4977 (2023).
PubMed: 37640715
Assembly members:
entity_1, polymer, 39 residues, Formula weight is not available
Natural source: Common Name: Encephalomyocarditis virus Taxonomy ID: 12104 Superkingdom: Viruses Kingdom: not available Genus/species: Cardiovirus Cardiovirus A
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GGGCAGAAGGUACCCCAUUG
UAUGGGAUCUGAUCUGCCC
| Data type | Count |
| 13C chemical shifts | 18 |
| 1H chemical shifts | 18 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Jdomain | 1 |
Entity 1, Jdomain 39 residues - Formula weight is not available
| 1 | G | G | G | C | A | G | A | A | G | G | ||||
| 2 | U | A | C | C | C | C | A | U | U | G | ||||
| 3 | U | A | U | G | G | G | A | U | C | U | ||||
| 4 | G | A | U | C | U | G | C | C | C |
sample_1: Jdomain, [U-2H,{13C8,1H2,1H8}-A, {13C8,1H8}-G], 1 mM; D2O 100%; potassium phosphate 10 mM; sodium chloride 10 mM
sample_conditions_1: ionic strength: 0.02 M; pH: 6.4; pressure: 1 atm; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-13C TROSY aromatic | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN - chemical shift assignment, peak picking, processing