BMRB Entry 17972
Click here to enlarge.
PDB ID: 2lk3
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17972
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Burke, Jordan; Sashital, Dipali; Zuo, Xiaobing; Wang, Yun-Xing; Butcher, Samuel. "Structure of the yeast U2/U6 snRNA complex." RNA 18, 673-683 (2012).
PubMed: 22328579
Assembly members:
RNA_(5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')_, polymer, 24 residues, 7716.717 Da.
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: cell free synthesis Host organism: E. coli - cell free Vector: N/A
Entity Sequences (FASTA):
RNA_(5'-R(*GP*GP*CP*UP*UP*AP*GP*AP*UP*CP*AP*GP*AP*AP*AP*UP*GP*AP*UP*CP*AP*GP*CP*C)-3')_: GGCUUAGAUCAGAAAUGAUC
AGCC
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 80 |
| 1H chemical shifts | 167 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | U2_U6snRNA | 1 |
Entities:
Entity 1, U2_U6snRNA 24 residues - 7716.717 Da.
| 1 | G | G | C | U | U | A | G | A | U | C | ||||
| 2 | A | G | A | A | A | U | G | A | U | C | ||||
| 3 | A | G | C | C |