Click here to enlarge.
PDB ID: 2m24
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18894
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kruschel, Daniela; Skilandat, Miriam; Sigel, Roland. "NMR structure of the 5'-splice site in the group IIB intron Sc.ai5--conformational requirements for exon-intron recognition." RNA ., .-. (2014).
PubMed: 24448450
Assembly members:
RNA_(29-MER), polymer, 29 residues, 9301.611 Da.
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: cell free synthesis Host organism: not applicable Vector: not applicable
Entity Sequences (FASTA):
RNA_(29-MER): GGAGUAUGUAUUGGCACUGA
GCAUACUCC
Data type | Count |
13C chemical shifts | 102 |
15N chemical shifts | 18 |
1H chemical shifts | 223 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | RNA (29-MER) | 1 |
Entity 1, RNA (29-MER) 29 residues - 9301.611 Da.
part of intron domain one; postion 5-25 correspond to 315-335 on intron (25657-25677 on gene); extended by 4 nt on each side
1 | G | G | A | G | U | A | U | G | U | A | ||||
2 | U | U | G | G | C | A | C | U | G | A | ||||
3 | G | C | A | U | A | C | U | C | C |