Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR26939
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Edelmann, Franziska; Schlundt, Andreas; Heym, Roland; Jenner, Andreas; Niedner-Boblenz, Annika; Syed, Muhammad; Paillart, Jean-Christophe; Stehle, Ralf; Janowski, Robert; Sattler, Michael; Jansen, Ralf-Peter; Niessing, Dierk. "Molecular architecture and dynamics of ASH1 mRNA recognition by its mRNA-transport complex" Nat. Struct. Biol. 24, 152-161 (2017).
PubMed: 28092367
Assembly members:
ASH1-E3_42mer, polymer, 42 residues, Formula weight is not available
Natural source: Common Name: baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: cell free synthesis Host organism: Saccharomyces cerevisiae Vector: PCR product
Entity Sequences (FASTA):
ASH1-E3_42mer: GAUAACUGAAUCGCUAAGGA
UGAAAGUCUAUGCGACAUUA
UC
| Data type | Count |
| 1H chemical shifts | 16 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | ASH1-mRNA E3 42mer stem-loop | 1 |
Entity 1, ASH1-mRNA E3 42mer stem-loop 42 residues - Formula weight is not available
Sequence comprises three fragments corresponding to A, B and C in the CS files. A (1774-1785) and B (1803-1811) are strands of the wt stem sequence and C is an artificial stem-loop (gcuaaggaugaaagucuaugc).
| 1 | G | A | U | A | A | C | U | G | A | A | ||||
| 2 | U | C | G | C | U | A | A | G | G | A | ||||
| 3 | U | G | A | A | A | G | U | C | U | A | ||||
| 4 | U | G | C | G | A | C | A | U | U | A | ||||
| 5 | U | C |
sample_1: ASH1-E3_42mer 200 uM; HEPES 20 mM; sodium chloride 150 mM; magnesium chloride 2 mM; H2O 90%; D2O 10%
sample_conditions_1: ionic strength: 0.15 M; pH: 7.5; pressure: 1 atm; temperature: 278 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
TOPSPIN v3.5, Bruker Biospin, CCPN - chemical shift assignment, collection
| PDB |