Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34843
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Orehova, Maria; Plavec, Janez; Kocman, VojC. "High-Resolution Structure of RNA G-Quadruplex Containing Unique Structural Motifs Originating from the 5'-UTR of Human Tyrosine Kinase 2 (TYK2)
" ACS Omega 9, 7215-7229 (2024).
PubMed: 38371751
Assembly members:
entity_1, polymer, 23 residues, 7507.481 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: CGGUAGCGGGUAUGGGUCCG
GGU
| Data type | Count |
| 1H chemical shifts | 113 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 23 residues - 7507.481 Da.
| 1 | C | G | G | U | A | G | C | G | G | G | ||||
| 2 | U | A | U | G | G | G | U | C | C | G | ||||
| 3 | G | G | U |
sample_1: RNA (5'-R(*CP*GP*GP*UP*AP*GP*CP*GP*GP*GP*UP*AP*UP*GP*GP*GP*UP*CP*CP*GP*GP*GP*U)-3') 0.5 ± 0.05 mM; potassium phosphate 10 ± 1 mM; potassium chloride 10 ± 1 mM
sample_2: RNA (5'-R(*CP*GP*GP*UP*AP*GP*CP*GP*GP*GP*UP*AP*UP*GP*GP*GP*UP*CP*CP*GP*GP*GP*U)-3') 1.0 ± 0.1 mM; potassium phosphate 10 ± 1 mM; potassium chloride 10 ± 1 mM
sample_3: RNA (5'-R(*CP*GP*GP*UP*AP*GP*CP*GP*GP*GP*UP*AP*UP*GP*GP*GP*UP*CP*CP*GP*GP*GP*U)-3') 0.8 ± 0.08 mM; potassium phosphate 10 ± 1 mM; potassium chloride 10 ± 1 mM; Pf1 phage 17 ± 1 mg/mL
sample_conditions_1: ionic strength: 20 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_2 | isotropic | sample_conditions_1 |
| IPAP-edited HSQC | sample_3 | anisotropic | sample_conditions_1 |
TopSpin, Bruker Biospin - collection
NMRFAM-SPARKY, National Magnetic Resonance Facility at Madison - chemical shift assignment
Amber, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation