Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6652
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Davis, Jared; Tonelli, Marco; Scott, Lincoln; Jaeger, Luc; Williamson, James; Butcher, Samuel. "RNA Helical Packing in Solution: NMR Structure of a 30kDa GAAA
Tetraloop-Receptor Complex." J. Mol. Biol. 351, 371-382 (2005).
PubMed: 16002091
Assembly members:
GAAA tetraloop 11-nt receptor RNA, polymer, 43 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
GAAA tetraloop 11-nt receptor RNA: GGGAUAUGGAAGAACCGGGG
AAACUUGGUUCUUCCUAAGU
CCU
| Data type | Count |
| 13C chemical shifts | 88 |
| 15N chemical shifts | 23 |
| 1H chemical shifts | 239 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | . | 1 |
| 2 | . | 1 |
Entity 1, .
sample_1: GAAA tetraloop 11-nt receptor RNA, [U-95% 13C; U-95% 15N], 1.2 mM; pf1 phage 17 ± 2 mM
conditions_1: pH: 6.8; temperature: 283 K
conditions_2: temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-1H NOESY | sample_1 | not available | not available |
| 1H-1H TOCSY | sample_1 | not available | not available |
| 1H-13C HSQC | sample_1 | not available | not available |
| HCCH-TOCSY | sample_1 | not available | not available |
| HCCH-COSY | sample_1 | not available | not available |
| HNN-COSY | sample_1 | not available | not available |
| 1H-13C-1H NOESY HMQC | sample_1 | not available | not available |
| F2f 13C 1H-1H NOESY | sample_1 | not available | not available |
| F1f F2e 13C 1H-1H NOESY F1e F2e 13C 1H-1H NOESY F1f 13C 1H-1H NOESY | sample_1 | not available | not available |
No software information available