Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR50668
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sreeramulu, Sridhar; Richter, Christian; Berg, Hannes; Wirtz Martin, Maria; Ceylan, Betul; Matzel, Tobias; Adam, Jennifer; Altincekic, Nadide; Azzaoui, Kamal; Bains, Jasleen Kaur; Blommers, Marcel; Ferner, Jan; Furtig, Boris; Gobel, M.; Grun, J Tassilo; Hengesbach, Martin; Hohmann, Katharina; Hymon, Daniel; Knezic, Bozana; Martins, Jason; Mertinkus, Klara; Niesteruk, Anna; Peter, Stephen; Pyper, Dennis; Qureshi, Nusrat; Scheffer, Ute; Schlundt, Andreas; Schnieders, Robbin; Stirnal, Elke; Sudakov, Alexey; Troster, Alix; Vogele, Jennifer; Wacker, Anna; Weigand, Julia; Wirmer-Bartoschek, Julia; Wohnert, Jens; Schwalbe, Harald. "Exploring the druggability of conserved RNA regulatory elements in the SARS-CoV-2 genome" Angew. Chem. Int. Ed. Engl. 60, 19191-19200 (2021).
PubMed: 34161644
Assembly members:
entity_1, polymer, 33 residues, Formula weight is not available
entity_2, non-polymer, Formula weight is not available
Natural source: Common Name: SARS-CoV-2 Taxonomy ID: 2697049 Superkingdom: Viruses Kingdom: not available Genus/species: Betacoronavirus HCoV-SARS
Experimental source: Production method: transcription Host organism: in-vitro
Entity Sequences (FASTA):
entity_1: GGGCUGCUUACGGUUUCGUC
CGUGUUGCAGCCC
Data type | Count |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | 5_SL5a | 1 |
2 | DSI-Poised Library (DSI-PL) | 2 |
Entity 1, 5_SL5a 33 residues - Formula weight is not available
1 | G | G | G | C | U | G | C | U | U | A | ||||
2 | C | G | G | U | U | U | C | G | U | C | ||||
3 | C | G | U | G | U | U | G | C | A | G | ||||
4 | C | C | C |
Entity 2, DSI-Poised Library (DSI-PL) - Formula weight is not available
sample_1: 5_SL5a 10 uM; potassium phosphate 25 mM; KCl 50 mM; H2O 95%; DMSO, [U-100% 2H], 5%; Fragment 1 200 uM; Fragment 2 200 uM; Fragment 3 200 uM; Fragment 4 200 uM; Fragment 5 200 uM; Fragment 6 200 uM; Fragment 7 200 uM; Fragment 8 200 uM; Fragment 9 200 uM; Fragment 10 200 uM; Fragment 11 200 uM; Fragment 12 200 uM
sample_2: potassium phosphate 25 mM; KCl 50 mM; H2O 95%; DMSO, [U-100% 2H], 5%; Fragment 1 200 uM; Fragment 2 200 uM; Fragment 3 200 uM; Fragment 4 200 uM; Fragment 5 200 uM; Fragment 6 200 uM; Fragment 7 200 uM; Fragment 8 200 uM; Fragment 9 200 uM; Fragment 10 200 uM; Fragment 11 200 uM; Fragment 12 200 uM
sample_conditions_1: ionic strength: 75 mM; pH: 6.2; pressure: 1 atm; temperature: 293 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
1D 1H | sample_1 | isotropic | sample_conditions_1 |
1D 1H waterLOGSY | sample_1 | isotropic | sample_conditions_1 |
1H R2 CPMG 5ms | sample_1 | isotropic | sample_conditions_1 |
1H R2 CPMG 100ms | sample_1 | isotropic | sample_conditions_1 |
1D 1H ref | sample_2 | isotropic | sample_conditions_1 |
1D 1H waterLOGSY ref | sample_2 | isotropic | sample_conditions_1 |
1H R2 CPMG 5ms ref | sample_2 | isotropic | sample_conditions_1 |
1H R2 CPMG 100ms ref | sample_2 | isotropic | sample_conditions_1 |
LOGS v2.2 - collection
TOPSPIN v4.0.9 - collection, data analysis