Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR27053
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kerkour, Abdelaziz; Marquevielle, Julien; Ivashchenko, Stefaniia; Yatsunyk, Liliya; Mergny, Jean-Louis; Salgado, Gilmar. "High-resolution 3D NMR structure of the KRAS proto-oncogene promoter reveals key features of a G-quadruplex involved in transcriptional regulation" J. Biol. Chem. 292, 8082-8091 (2017).
PubMed: 28330874
Assembly members:
KRAS22RT, polymer, 22 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
KRAS22RT: AGGGCGGTGTGGGAATAGGG
AA
| Data type | Count |
| 1H chemical shifts | 218 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | G4 within promoter region | 1 |
Entity 1, G4 within promoter region 22 residues - Formula weight is not available
| 1 | DA | DG | DG | DG | DC | DG | DG | DT | DG | DT | ||||
| 2 | DG | DG | DG | DA | DA | DT | DA | DG | DG | DG | ||||
| 3 | DA | DA |
sample_KRAS22RT: KRAS22RT 2.5 mM; KCl 90 mM; KPi 20 mM
sample_conditions_1: ionic strength: 110 mM; pH: 6.65; pressure: 1 atm; temperature: 293 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_KRAS22RT | isotropic | sample_conditions_1 |
SPARKY, Goddard - chemical shift assignment