Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR52479
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Yared, Marcel-Joseph; Chagneau, Carine; Barraud, Pierre. "Imino chemical shift assignments of tRNAAsp, tRNAVal and tRNAPhe from Escherichia coli" Biomol. NMR Assignments 18, 323-331 (2024).
PubMed: 39365419
Assembly members:
entity_1, polymer, 76 residues, Formula weight is not available
Natural source: Common Name: E. coli Taxonomy ID: 562 Superkingdom: Bacteria Kingdom: not available Genus/species: Escherichia coli
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
entity_1: GCCCGGAUAGCUCAGUCGGU
AGAGCAGGGGAUUGAAAAUC
CCCGUGUCCUUGGUUCGAUU
CCGAGUCCGGGCACCA
Data type | Count |
15N chemical shifts | 24 |
1H chemical shifts | 24 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unmodified tRNAPhe | 1 |
Entity 1, unmodified tRNAPhe 76 residues - Formula weight is not available
1 | G | C | C | C | G | G | A | U | A | G | ||||
2 | C | U | C | A | G | U | C | G | G | U | ||||
3 | A | G | A | G | C | A | G | G | G | G | ||||
4 | A | U | U | G | A | A | A | A | U | C | ||||
5 | C | C | C | G | U | G | U | C | C | U | ||||
6 | U | G | G | U | U | C | G | A | U | U | ||||
7 | C | C | G | A | G | U | C | C | G | G | ||||
8 | G | C | A | C | C | A |
sample_1: unmodified E. coli tRNAPhe 1.0 mM; sodium phosphate 10 mM; magnesium chloride 10 mM; D2O 5%
sample_2: unmodified E. coli tRNAPhe, [U-15N]-Ura/Gua, 0.45 mM; sodium phosphate 10 mM; magnesium chloride 10 mM; D2O 5%
sample_conditions_1: ionic strength: 30 mM; pH: 6.0; pressure: 1 atm; temperature: 311 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N TROSY | sample_2 | isotropic | sample_conditions_1 |
TOPSPIN - collection, processing
NMRFAM-SPARKY - chemical shift assignment