Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17316
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Jiachen; Nikonowicz, Edward. "Solution Structure of the K-Turn and Specifier Loop Domains from the Bacillus subtilis tyrS T-Box Leader RNA." J. Mol. Biol. 408, 99-117 (2011).
PubMed: 21333656
Assembly members:
Specifier_Domain_and_GA_motif_region_of_B._subtilis_tyrS_T_box_leader_RNA, polymer, 55 residues, 244.204 Da.
Natural source: Common Name: firmicutes Taxonomy ID: 1423 Superkingdom: Bacteria Kingdom: not available Genus/species: Bacillus subtilis
Experimental source: Production method: enzymatic semisynthesis Vector: n/a
Entity Sequences (FASTA):
Specifier_Domain_and_GA_motif_region_of_B._subtilis_tyrS_T_box_leader_RNA: GGGAGUAAAGAUUGAGACAA
GUAGGACUUCGGUCCGAAUA
CACUCAUGAACUCCC
Data type | Count |
13C chemical shifts | 347 |
15N chemical shifts | 18 |
1H chemical shifts | 408 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | hairpin 1 | 1 |
Entity 1, hairpin 1 55 residues - 244.204 Da.
1 | G | G | G | A | G | U | A | A | A | G | ||||
2 | A | U | U | G | A | G | A | C | A | A | ||||
3 | G | U | A | G | G | A | C | U | U | C | ||||
4 | G | G | U | C | C | G | A | A | U | A | ||||
5 | C | A | C | U | C | A | U | G | A | A | ||||
6 | C | U | C | C | C |
sample_1: Specifier Domain and GA motif region of B. subtilis tyrS T box leader RNA, [U-100% 13C; U-100% 15N], 1 mM; D2O 100%
sample_2: Specifier Domain and GA motif region of B. subtilis tyrS T box leader RNA, [U-100% 13C; U-100% 15N], 1 mM; D2O 10%; H2O 90%
sample_conditions_1: pH: 6.8; pressure: 1 atm; temperature: 273 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
3D 1H-13C NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
3D 1H-15N NOESY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-13C HSQC | sample_2 | oriented | sample_conditions_1 |
3D HCCH-COSY | sample_1 | isotropic | sample_conditions_1 |
3D HCN | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D 1H-13C ct-spin-echo difference | sample_1 | isotropic | sample_conditions_1 |
VNMRJ, Varian - collection