Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30262
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Tolbert, M.; Morgan, C.; Pollum, M.; Crespo-Hernandez, C.; Li, M.; Brewer, G.; Tolbert, B.. "HnRNP A1 Alters the Structure of a Conserved Enterovirus IRES Domain to Stimulate Viral Translation.
" J. Mol. Biol. 429, 2841-2858 (2017).
PubMed: 28625847
Assembly members:
entity_1, polymer, 41 residues, 13075.822 Da.
Natural source: Common Name: Enterovirus A71 Taxonomy ID: 39054 Superkingdom: Viruses Kingdom: not available Genus/species: Enterovirus A71
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGAUCAACCCCAGGUGUGGC
ACACCAGUCAUACCUUGAUC
C
| Data type | Count |
| 1H chemical shifts | 110 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 41 residues - 13075.822 Da.
| 1 | G | G | A | U | C | A | A | C | C | C | ||||
| 2 | C | A | G | G | U | G | U | G | G | C | ||||
| 3 | A | C | A | C | C | A | G | U | C | A | ||||
| 4 | U | A | C | C | U | U | G | A | U | C | ||||
| 5 | C |
sample_1: rNTP, Fully protonated, 220 ± 0.2 uM
sample_2: rNTP, Fully protonated, 300 ± 0.2 uM
sample_conditions_1: ionic strength: 10 mM; pH: 6.5; pressure: 1 .; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement
NMRDraw, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
NMRView, Johnson, One Moon Scientific - chemical shift assignment
TOPSPIN, Bruker Biospin - collection
X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - structure calculation