Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR25100
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Miller, Sarah; Yildiz, F.; Lo, Jennifer; Wang, Bo; D'Souza, Victoria. "A structure-based mechanism for tRNA and retroviral RNA remodelling during primer annealing
" Nature 515, 591-595 (2014).
PubMed: 25209668
Assembly members:
MLV_Nucleocapsid, polymer, 55 residues, Formula weight is not available
RNA_(71-MER), polymer, 74 residues, Formula weight is not available
ZINC ION, non-polymer, 65.409 Da.
Natural source: Common Name: Murine Leukemia Virus Taxonomy ID: 11786 Superkingdom: not available Kingdom: not available Genus/species: Gammaretrovirus not available
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pCNA
Entity Sequences (FASTA):
MLV_Nucleocapsid: ATVVSGQKQDRQGGERRRSQ
LDRDQCAYCKEKGHWAKDCP
KKPRGPRGPRPQTSL
RNA_(71-MER): GGCUCGUUGGUCUAGGGGUA
UGAUUCUCGCUUAGGGUGCG
AGAGGUCCCGGGUUCAAAUC
CCGGACGAGCCCCA
| Data type | Count |
| 13C chemical shifts | 33 |
| 1H chemical shifts | 303 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | RNA (71-MER), 1 | 2 |
| 3 | RNA (71-MER), 2 | 2 |
| 4 | ZINC ION_1 | 3 |
| 5 | ZINC ION_2 | 3 |
Entity 1, entity_1 55 residues - Formula weight is not available
| 1 | ALA | THR | VAL | VAL | SER | GLY | GLN | LYS | GLN | ASP | ||||
| 2 | ARG | GLN | GLY | GLY | GLU | ARG | ARG | ARG | SER | GLN | ||||
| 3 | LEU | ASP | ARG | ASP | GLN | CYS | ALA | TYR | CYS | LYS | ||||
| 4 | GLU | LYS | GLY | HIS | TRP | ALA | LYS | ASP | CYS | PRO | ||||
| 5 | LYS | LYS | PRO | ARG | GLY | PRO | ARG | GLY | PRO | ARG | ||||
| 6 | PRO | GLN | THR | SER | LEU |
Entity 2, RNA (71-MER), 1 74 residues - Formula weight is not available
| 1 | G | G | C | U | C | G | U | U | G | G | ||||
| 2 | U | C | U | A | G | G | G | G | U | A | ||||
| 3 | U | G | A | U | U | C | U | C | G | C | ||||
| 4 | U | U | A | G | G | G | U | G | C | G | ||||
| 5 | A | G | A | G | G | U | C | C | C | G | ||||
| 6 | G | G | U | U | C | A | A | A | U | C | ||||
| 7 | C | C | G | G | A | C | G | A | G | C | ||||
| 8 | C | C | C | A |
Entity 3, ZINC ION_1 - Zn - 65.409 Da.
| 1 | ZN |
sample_1: NC-tRNApro (1:1) 0.5 mM; MgCl2 1 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%
sample_2: NC-tRNApro (1:1), 13C, 15N G-lab tRNA-pro, 0.5 mM; MgCl2 1 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%
sample_3: NC-tRNApro (1:1), 13C, 15N G-lab tRNA-pro, 0.5 mM; MgCl2 1 mM; NaCl 10 mM; Tris 10 mM; H2O 90%; D2O 10%
sample_conditions_1: pH: 7.2; pressure: 1 atm; temperature: 311 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13N HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_1 |
| 2D NOESY | not available | isotropic | sample_conditions_1 |
AMBER, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollman, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax, Johnson, One Moon Scientific - data analysis, processing, refinement