BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19996

Title: Backbone chemical shifts of the murine ROQUIN-1 ROQ domain in complex with Tnf CDE 23mer RNA

Deposition date: 2014-05-30 Original release date: 2014-07-01

Authors: Schlundt, Andreas; Sattler, Michael

Citation: Schlundt, Andreas; Heinz, Gitta; Janowski, Robert; Geerlof, Arie; Stehle, Ralf; Heissmeyer, Vigo; Niessing, Dierk; Sattler, Michael. "Structural basis for RNA recognition in roquin-mediated post-transcriptional gene regulation"  Nat. Struct. Biol. ., .-. (2014).

Assembly members:
ROQ_domain_of_Roquin-1, polymer, 183 residues, 20758.8 Da.
Tnf_CDE_RNA_23mer, polymer, 23 residues, 7004.5 Da.

Natural source:   Common Name: Mouse   Taxonomy ID: 10090   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Mus musculus

Experimental source:   Production method: recombinant technology' 'Escherichia coli' . . . Escherichia coli 'BL21 (DE3)   Vector: 19996

Entity Sequences (FASTA):
ROQ_domain_of_Roquin-1: GAMEEEGRIRAMRAARSLGE RTVTELILQHQNPQQLSSNL WAAVRARGCQFLGPAMQEEA LKLVLLALEDGSALSRKVLV LFVVQRLEPRFPQASKTSIG HVVQLLYRASCFKVTKRDED SSLMQLKEEFRTYEALRREH DSQIVQIAMEAGLRIAPDQW SSLLYGDQSHKSHMQSIIDK LQT
Tnf_CDE_RNA_23mer: ACAUGUUUUCUGUGAAAACG GAG

Data sets:
Data typeCount
1H chemical shifts166
13C chemical shifts444
15N chemical shifts166

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1ROQ1
2Tnf2

Entities:

Entity 1, ROQ 183 residues - 20758.8 Da.

starts with 147

1   GLYALAMETGLUGLUGLUGLYARGILEARG
2   ALAMETARGALAALAARGSERLEUGLYGLU
3   ARGTHRVALTHRGLULEUILELEUGLNHIS
4   GLNASNPROGLNGLNLEUSERSERASNLEU
5   TRPALAALAVALARGALAARGGLYCYSGLN
6   PHELEUGLYPROALAMETGLNGLUGLUALA
7   LEULYSLEUVALLEULEUALALEUGLUASP
8   GLYSERALALEUSERARGLYSVALLEUVAL
9   LEUPHEVALVALGLNARGLEUGLUPROARG
10   PHEPROGLNALASERLYSTHRSERILEGLY
11   HISVALVALGLNLEULEUTYRARGALASER
12   CYSPHELYSVALTHRLYSARGASPGLUASP
13   SERSERLEUMETGLNLEULYSGLUGLUPHE
14   ARGTHRTYRGLUALALEUARGARGGLUHIS
15   ASPSERGLNILEVALGLNILEALAMETGLU
16   ALAGLYLEUARGILEALAPROASPGLNTRP
17   SERSERLEULEUTYRGLYASPGLNSERHIS
18   LYSSERHISMETGLNSERILEILEASPLYS
19   LEUGLNTHR

Entity 2, Tnf 23 residues - 7004.5 Da.

Sequence: 5'- ACA UGU UUU CUG UGA AAA CGG AG -3'

1   ACAUGUUUUC
2   UGUGAAAACG
3   GAG

Samples:

sample_1: ROQ domain of Roquin-1' '[U-98% 13C; U-98% 15N] 200; .; .; . mM; 2, $Tnf_CDE_RNA_23mer,

sample_conditions_1: temperature: 298 K; pH: 7.0; pressure: 1 atm; ionic strength: 150 mM

Experiments:

NameSampleSample stateSample conditions
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
3D HNCAsample_1isotropicsample_conditions_1
3D HNCACBsample_1isotropicsample_conditions_1
3D HNCOsample_1isotropicsample_conditions_1
3D HCACOsample_1isotropicsample_conditions_1

Software:

CCPN_Analysis v2, CCPN - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz

Related Database Links:

UNP Q4VGL6
BMRB 25021
PDB
DBJ BAC23121 BAD32613 BAE24092 BAG53813
EMBL CAG07670 CDQ65000 CDQ67780 CDQ69323
GB AAH68669 AAI36785 AAI38664 AAI44409 AAI52932
REF NP_001020123 NP_001076328 NP_001084548 NP_001108155 NP_001287779
SP Q4VGL6 Q5TC82 Q6NUC6
TPG DAA21174

Download simulated HSQC data in one of the following formats:
CSV: Backbone or all simulated shifts
SPARKY: Backbone or all simulated shifts