Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, LACS
BMRB Entry DOI: doi:10.13018/BMR16812
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lowry, Jason; Gamsjaeger, Roland; Thong, Sock Yue; Hung, Wendy; Kwan, Ann; Broitman-Maduro, Gina; Matthews, Jacqueline; Maduro, Morris; Mackay, Joel. "Structural analysis of MED-1 reveals unexpected diversity in the mechanism of DNA recognition by GATA-type zinc finger domains." J. Biol. Chem. 284, 5827-5835 (2009).
PubMed: 19095651
Assembly members:
MED1zf, polymer, 65 residues, 6728.883 Da.
ZN, non-polymer, 65.409 Da.
DNA, polymer, . residues, Formula weight is not available
Natural source: Common Name: Caenorhabditis elegans Taxonomy ID: 6239 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Caenorhabditis elegans
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: pET15b
Entity Sequences (FASTA):
MED1zf: KSFQCSNCSVTETIRWRNIR
SKEGIQCNACFIYQRKYNKT
RPVTAVNKYQKRKLKVQETN
GVDSF
DNA: CGGAAAAGTATACTTTTCCG
| Data type | Count |
| 13C chemical shifts | 145 |
| 15N chemical shifts | 65 |
| 1H chemical shifts | 299 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | MED1zf | 1 |
| 2 | ZINC ION | 2 |
| 3 | DNA | 3 |
Entity 1, MED1zf 65 residues - 6728.883 Da.
| 1 | LYS | SER | PHE | GLN | CYS | SER | ASN | CYS | SER | VAL | ||||
| 2 | THR | GLU | THR | ILE | ARG | TRP | ARG | ASN | ILE | ARG | ||||
| 3 | SER | LYS | GLU | GLY | ILE | GLN | CYS | ASN | ALA | CYS | ||||
| 4 | PHE | ILE | TYR | GLN | ARG | LYS | TYR | ASN | LYS | THR | ||||
| 5 | ARG | PRO | VAL | THR | ALA | VAL | ASN | LYS | TYR | GLN | ||||
| 6 | LYS | ARG | LYS | LEU | LYS | VAL | GLN | GLU | THR | ASN | ||||
| 7 | GLY | VAL | ASP | SER | PHE |
Entity 2, ZINC ION - Zn - 65.409 Da.
| 1 | ZN |
Entity 3, DNA - Formula weight is not available
| 1 | DC | DG | DG | DA | DA | DA | DA | DG | DT | DA | |
| 2 | DT | DA | DC | DT | DT | DT | DT | DC | DC | DG |
sample_1: sodium chloride 40 mM; potassium phosphate 20 mM; DTT 1 mM; H2O 90%; D2O 10%; protein, [U-100% 13C; U-100% 15N, 0.5 1 mM
sample_2: sodium chloride 40 mM; potassium phosphate 20 mM; DTT 1 mM; Pf1 phage 6 mg; H2O 90%; D2O 10%; protein, [U-100% 13C; U-100% 15N, 0.5 1 mM
sample_conditions_1: pH: 6.5; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
| 3D CBCA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCO | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCA | sample_1 | isotropic | sample_conditions_1 |
| 3D HNCACB | sample_1 | isotropic | sample_conditions_1 |
| 3D HBHA(CO)NH | sample_1 | isotropic | sample_conditions_1 |
| 3D HCCH-TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 3D HNHA | sample_1 | isotropic | sample_conditions_1 |
| 3D 1H-15N NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | anisotropic | sample_conditions_1 |
CNS, Brunger A. T. et.al. - refinement
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks