BMRB Entry 17655
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17655
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Heddi, Brahim; Phan, Anh Tuan. "Structure of Human Telomeric DNA in Crowded Solution" J. Am. Chem. Soc. ., .-..
Assembly members:
DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_, polymer, 23 residues, 7287.750 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
DNA_(5'-D(*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*GP*GP*G)-3')_: TAGGGTTAGGGTTAGGGTTA
GGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 175 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Human Telomeric DNA | 1 |
Entities:
Entity 1, Human Telomeric DNA 23 residues - 7287.750 Da.
| 1 | DT | DA | DG | DG | DG | DT | DT | DA | DG | DG | ||||
| 2 | DG | DT | DT | DA | DG | DG | DG | DT | DT | DA | ||||
| 3 | DG | DG | DG |
Samples:
sample_1: Human_Telomeric_DNA0.2 – 1 mM; PEG 200 mM; H2O mM
sample_conditions_1: pH: 7.00; pressure: 1 atm; temperature: 310 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H COSY | sample_1 | isotropic | sample_conditions_1 |
Software:
X-PLOR NIH v2.26, Schwieters, Kuszewski, Tjandra and Clore - structure solution
AMBER v10.0, Case, Darden, Cheatham, III, Simmerling, Wang, Duke, Luo, ... and Kollm - refinement
NMR spectrometers:
- Bruker AMX 600 MHz
- Bruker AMX 700 MHz