BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Query Grid

Select desired data type(s) and optionally limit polymer type(s). You can select multiple values by holding the "control" key (Windows, Linux) or "option" key (MacOS) while clicking. All data type selections are applied using a logical AND operator. Polymer selection join type can be selected. Click a column header to sort by that column.

 

Number of entries returned: 7440

Download all matching entries in NMR-STAR as a compressed file or download the results displayed on this page in CSV format.

BMRB IDSystem NamePDB structureProteinDNARNAOther
3322endoglucanase Cel45A1E8P 1E8Q X
4020Bovine Syncytial Respiratory Virus-G1BRV X
4023staphylococcal protein A Z domain2SPZ 1Q2N X
4052staphylococcal nuclease1JOO X
4053staphylococcal nuclease1JOQ X
4089peptide deformylase2DEF X
4090Transposase2EZH X
4114B-MYB1A5J X
4120TYMV pseudoknot1A60 X
4129Nereis diversicolor sarcoplasmic calcium-binding protein1Q80 X
4141vnd/NK-2 homeodomain DNA complex1NK2 XX
4147Cold Shock domain1H95 X
4148cellulose-binding domain4BMF X
4153Retinoid-X-Receptor -alpha DNA Binding domain1RXR X
4155Eotaxin1EOT X
4156Protein Disulfide Isomerase1BJX X
4157lactoferricin1LFC X
4172Rev-erb beta response element1BN9 X
4173stromelysin-1 subunit 11BM6 X
4175SL3 RNA hairpin1BN0 X
4176DNA dodecamer1BJD X
4177Monocyte chemoattractant protein-31BO0 X
4181ferredoxin1PFD X
4182reduced rubredoxin1BFY X
4184eps15 homology domain1EH2 X
4186CRABPII system1BLR X
4187Sigma-K RNA Polymerase Promoter Consensus Sequence1SKP X
4188C2 Domain of Cytosolic Phospholipase A21BCI X
4189cytochrome c1GIW X
4190Bmtx11BIG X
4191Bmtx22BMT X
4192vpr fragment, HIV viral protein1BDE X
4194D-Pro melittin1BH1 X
4195Alpha-Bungaratoxin/Library Peptide Complex2BTX X
4197M13 major coat protein2CPS X
4198N-terminal domain of syntaxin 1A1BR0 X
4199N-term linker Type III Antifreeze protein RD33NLA X
4200c-Myc-Max Heterodimeric Leucine Zipper1A93 X
4201[ABA6,20] mEGF4-481A3P X
4202Superoxide Dismutase1BA9 1RK7 X
4204Insulin-like growth factor-I (Somatomedin C)1BQT X
4206fibronectin1MFN X
4207CRO Repressor Insertion Mutant K56-[DGEVK]2ORC X
4208CytC(Y64A)2DVH X
4209M13 major coat protein2CPB X
4210hTRF11BA5 X
4211giant ragweed allergen 51BBG X
4212synthetic L-peptide corresponding the the G-H loop of the foot-and-mouth disease virus VP1 protein1BCV X
4213retro-inverso peptide1BFW X
4214Tissue Inhibitor of Metalloproteinases-2 (TIMP-2)2TMP X
4215Staphylokinase1SSN X
4216CRE-BP11BHI X
4217streptomyces metalloproteinase inhibitor1BHU X
4218Toxin 2 from Centruroides noxius hoffmann1CN2 X
4219eel calcitonin1BKU X
4220HIV-1 capsid1BMX X
4221Moloney Murine Leukemia Virus Capsid Protein1BM4 X
4222monellin1MNL X
4223TATA box binding protein associated factor II 2301TBA X
4224Myotrophin1MYO X
4225Glutaredoxin 3 system3GRX X
4226lead-dependent ribozyme1LDZ X
4227DNAJ1BQZ X
4228DNAJ1BQ0 X
4229Fe8S8 Fd1BQX X
42303-ketosteroid isomerase-19-nortestosterone-hemisuccinate1BUQ X
4231ferredoxin1BWE X
4232Calcium binding subunit of troponin, TnC monomer1ZAC X
4235DNA decamer1BWT X
4241Internal xylan binding domain from XYLD2XBD X
4242Major Sperm Protein3MSP X
4243DNA (5'-D(TCCCGTTTCCA)-3')1C11 X
4244alphaT decamer duplex1BX5 X
4246CMTI-I(M8L)2V1V X
4248Lymphoid enhancer-binding factor2LEF XX
4249Human NER factor XPA1XPA X
42503' hairpin of TYMV pseudoknot3PHP X
4254Mbp11L3G X
4255Eukaryotic translation initiation factor 12IF1 X
4257Vpr HIV-1 (LAI)1VPC 1X9V X
4260GlcNAc eel calcitonin1BYV X
4261M6 eel calcitonin1BZB X
4262DIHYDROFOLATE REDUCTASE1BZF X
4263PTB domain of Drosophila Numb protein/GPpY peptide complex2NMB X
4264Phosphotransferase system, enzyme I3EZA 1VRC X
4265Dynein light chain 11DS9 1M9L X
42687-Fe Ferredoxin1BD6 X
4269gamma delta resolvase catalytic core1GHT 1HX7 X
4271Calcium binding protein from Entamoeba Histolytica1JFJ 1JFK X
4276Plasminogen1B2I X
4281AbrBN1Z0R X
4285S100A dimer1K2H X
4292plasmatocyte-spreading peptide1B1V X
42996-hydroxymethyl-7,8-dihydropterin pyrophosphokinase2F63 X
4300HPPK-AMPPCP complex2F65 X
4312bromodomain1JM4 X
4313ARD1ZRR X
4334ARID domain of dead-ringer protein1KQQ X
4342Frataxin1LY7 X
4347Alpha2D1QP6 X
4351granulin N-terminal peptide1QGM X
4372apt1C32 1C34 X
4373UNC-89 PH domain1FHO X
4378calcium loaded un-myristoylated rat frequenin2LCP X
4386REGULATOR OF G-PROTEIN SIGNALING 41EZY X
4387thanatin8TFV X
4391candoxin1JGK X
4392DNA minor groove binder1B0S 1CYZ X
4394TRANSLATION INITIATION FACTOR IF32IFE X
4395RIBOSOMAL PROTEIN L251B75 X
4396Nematode Anticoagulant Protein c21COU X
4397fractalkine1B2T X
4398neuropeptide Y1QFA X
4399ImI1CNL X
4400H-y5 Triple Helix1B4Y X
4401skeletal N-troponin C1BLQ X
4405hnRNP K1KHM X
4406contryphan-R1QFB X
4407Gaip protein1CMZ X
4409DNA (5'-D(*CP*GP*CP*AP*(HYD)TP*+TP*AP*CP*GP*C)- 3')1QKG X
4412DNA (5'-D(*CP*GP*CP*AP*TP*+TP*AP*CP*GP*C)- 3')1QL5 X
4413p731COK X
4414plastocyanin1B3I X
4415DNA dodecamer duplex1TTD X
4416Cis-syn thymine cyclobutane dimer1COC X
4417Major Pollen Allergen Bet v 1-L1B6F X
4418cytotoxin 2, minor form1CCQ X
4419cytotoxin 2, major form1CB9 X
4420ALPHA-CONOTOXIN IM11IM1 X
4422Apis mellifera chymotrypsin inhibitor1CCV X
4424ribonuclease HI1QHK X
4425ACETYL-COA CARBOXYLASE3BDO X
4426ACETYL-COA CARBOXYLASE2BDO X
4427toxin 71QKY X
4428HEADPIECE DOMAIN FROM CHICKEN VILLIN1QQV X
4429ribosomal protein L7 from E. coli1RQU 1RQV X
4430CALCYCLIN (RABBIT)2CNP 1JWD X
4431methane monooxygenase regulatory protein B1CKV X
4437MEROZOITE SURFACE PROTEIN 11CEJ X
4445HRDC domain1D8B X
4447p23fyp1H7Y 1H6Q X
4448Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase1F3Y X
4452sea raven Type II antifreeze protein2AFP X
4455CD58 adhesion domain, 1dCD581CI5 X
4461Cycloviolacin O11DF6 X
4467chicken MeCP2/ARBP monomer1UB1 X
4473Camp dependent protein kinase type ii regulatory chain1R2A 1L6E X
4475Low Density Lipoprotein Receptor Related Protein1CR8 X
4476Potassium channel1B4G X
4477Potassium channel1B4I X
4478PKD1 HUMAN1B4R X
4483LCA1CB3 X
4486METHANE MONOOXYGENASE REGULATORY PROTEIN B2MOB X
4487API1CE3 X
4488DNA decamer1CFL X
4490alpha-amylase inhibitor1QFD X
4491Eps151QJT X
4492guanylate cyclase activating protein 21JBA X
4493Ubiquitin core mutant 1D71UD7 X
4494IGF-I3LRI X
4496Tom201OM2 X
4497Heat shock cognate 70 kd protein 17HSC X
4498GAG MPMV1CL4 X
4500w-conotoxin MVIIC1CNN X
4503alpha-conotoxin SI1QMW X
4506type IIA bacteriocin carnobacteriocin B21CW5 X
4507Type IIa bacteriocin leucocin A1CW6 X
4509crambin1CXR X
4510The Second Fibronectin Type II Module From Human Matrix Metalloproteinase 21CXW X
4514Third complement-like repeat (CR3) from lipoprotein receptor related protein1D2L X
4516HUMAN PHOSPHATASE HPTP1E/PEPTIDE1D5G X
4519Translation initiation factor 1A1D7Q X
4522MAP301D8V X
4524Endoglucanase SS dockerin domain1DAQ X
4526CYCLIN-DEPENDENT KINASE 4 INHIBITOR A (P16INK4A)1DC2 X
4527NITROGEN REGULATION PROTEIN1DC7 X
4528NITROGEN REGULATION PROTEIN C1DC8 X
45365'-D(*AP*GP*GP*AP*TP*CP*CP*TP*UP*TP*TP*GP*GP*AP*TP*CP*CP*T)-3'1DGO X
4540ARC repressor1QTG 1NLA X
4541Potassium Channel Scorpion Toxin HsTX11QUZ X
45425'-D(*AP*GP*GP*AP*TP*CP*CP*TP*TP*TP*UP*GP*GP*AP*TP*CP*CP*T)-3'1QE7 X
4547DNA/RNA1C2Q XX
45505'-D(*GP*CP*GP*TP*TP*AP*AP*CP*GP*C)-3'1CQO X
455150S RIBOSOMAL PROTEIN L91CQU X
4552indolicidin1G8C X
4553Inserted domain of the leukocyte function associated antigen-1 in the presence of magnesium1DGQ X
4557herpes simplex virus protein ICP471QLO X
4566bovine adrenodoxin1L6U 1L6V X
4570SSO7D1B4O X
4574CIDE-N DOMAIN OF HUMAN CIDE-B1D4B X
4577RIBOSOMAL PROTEIN S4 DELTA 411C05 X
4579FYVE domain of EEA11HYJ 1HYI X
4581CALBINDIN D9K1D1O X
4583RNA POLYMERASE ALPHA SUBUNIT (2.7.7.-)1DOQ X
4584DNA BINDING DOMAIN OF THE TRAM PROTEIN1DP3 X
4585BMP02 NEUROTOXIN1DU9 X
4587Viscotoxin A3 from Viscum album L.1ED0 X
4588ChBD-ChiA11ED7 X
4589scaffoldin protein1EHX X
4590EOTAXIN-21EIG 1EIH X
4591syndecan-4 whole cytoplasmic domain1EJP X
4592Syndecan 41EJQ X
4593Rous sarcoma virus capsid protein: C-terminal domain1EOQ X
4595cystic fibrosis transmembrane conductance regulator (CFTR)1CKW X
4596cystic fibrosis transmembrane conductance regulator (CFTR)1CKX X
4597Cystic fibrosis transmembrane conductance regulator (CFTR)1CKY X
4598CYSTIC FIBROSIS TRANSMEMBRANE CONDUNTANCE REGULATOR (CFTR)1CKZ X
4599heat shock cognate 70 kd protein 17HSC X
4600GAG Polyprotein1CL4 X
4601Zervamicin IIB1DLZ X
4602CYTOCHROME B51DO9 X
4603APO-D-ALANYL CARRIER PROTEIN1DV5 X
4604THE PEPTAIBOL CHRYSOSPERMIN C BOUND TO DPC MICELLES1EE7 X
4607PAPILLOMAVIRUS E6-ASSOCIATED PROTEIN1EQX X
4609T-tetrad telomere repeats1EMQ X
46105'-D(*AP*GP*GP*GP*T)-3'1EVM X
46125'-D(*TP*GP*GP*GP*CP*GP*GP*T)-3'1EVO X
46145'-r(*GP*CP*AP*GP*GP*CP*GP*UP*GP*C)-3'1F5G X
4615antifungal peptide1DKC X
4616Light-harvesting protein b-875, beta chain1DX7 X
4617serine protease1DXW X
4618DNA1DXN X
4619Human immunodeficiency virus type 2 integrase1E0E X
4620prion protein1E1U X
4621NOT41E4U X
4622UvrB C-terminal domain1E52 X
4623XYLANASE D1E5C X
4628H141G9E X
4630THROMBOMODULIN1DQB X
4631SKELETAL DIHYDROPYRIDINE RECEPTOR1DU1 X
4633MONELLIN1FUW X
4634Multifunctional aminoacyl-tRNA synthetase(E.C.6.1.1.17)1FYJ X
4635MAD1 PROTEIN/SIN3A1G1E 1S5R 1S5Q X
4636Tumor necrosis factor receptor type 1 associated death domain protein1F2H X
4637MATING-TYPE PROTEIN A-11F43 X
4638MNEI, A SINGLE CHAIN SWEET PROTEIN1FA3 X
4639human Rap11FEX X
4640DEFENSIN MGD-11FJN X
4641HUMAN PRION PROTEIN (MUTANT E200K)1FO7 X
4642HUMAN BETA-DEFENSIN-21FQQ X
4643MYELOID ANTIMICROBIAL PEPTIDE1FRY X
4644FIRST ZINC FINGER FROM THE DROSOPHILA U-SHAPED TRANSCRIPTION FACTOR1FV5 X
4645ORYZAIN BETA CHAIN1FWO X
4646DNA1FYI X
4647HPRT Gene Mutation Hotspot with a BPDE2(10R) Adduct1FYY X
4648Phosphoglycerate Mutase (E.C.5.4.2.1)1FZT X
4649HTLV-I CAPSID PROTEIN1G03 X
4650SHEEP PRION PEPTIDE1G04 X
4651Rhodopsin1FDF X
4652amino terminus of Rhodopsin (residues 1-40)1EDX X
4653Third intradiskal loop of RHODOPSIN (Residues 268-293)1EDW X
4654SECOND INTRADISKAL LOOP OF RHODOPSIN (RESIDUES 172-205)1EDV X
4655First intradiskal loop of RHODOPSIN (residues 93-123)1EDS X
4656GRANULIN A1G26 X
4661Apoptotic protease activating factor 11C15 X
4663protein (1D8 UBIQUITIN) mutant (I3L,I13L,L15V,V17L,I23V,V26L,I61L,L67I)1C3T X
4664lipocalin Q831JZU X
4666transcarboxylase 1.3S subunit1DCZ 1DD2 X
4668FK506 binding protein from Methanococcus thermolithotrophicus1IX5 X
4669HEPATITIS C CAPSID PROTEIN1CWX X
4677cysteine-rich domain of DnaJ Chaperone1EXK X
4679Human Collagenase-31FM1 1FLS X
4682Rat holo-cellular retinol-binding protein II1EII X
4688L181ILY X
4692TELOMERE FRAGMENT1EL2 X
4697fMet-tRNA binding domain of initiation factor IF21D1N X
4700Cdc42 + fragment of PAK1CF4 X
4701mouse p15(INK4B) tumor suppressor1D9S X
4706CELLULOSE BINDING DOMAIN N2 FROM C. FIMI ENDOGLUCANASE C1CX1 X
4716auxilin1N4C X
4717C-terminal FtsZ binding domain of E. coli ZipA1F7W 1F7X X
4721general transcription factor TFIIE-BETA1D8J X
4725metallothionein1J5M X
4735olfactory marker protein1JYT X
4738Cu(II) Plastocyanin from Anabaena variabilis1FA4 1FAF X
4740MTH1184 monomer1GH9 X
4743CYTOCHROME C71EHJ 1LM2 X
4745Bulged RNA1K8S X
4751mouse lysozyme1IVM X
4752gpnu1-E681J9I X
4754metallothionein1J5L X
4757C-terminal UBA Domain of HHR23A1DV0 X
4759cytochrome b5621QPU X
4760Pandinotoxin K-beta1C49 X
4771tola31S62 X
4775SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD21DUJ X
4778Cell Division Control Protein 42 from Candida albicans1FI6 X
4779Ligand Binding Domain of the Human TGF-beta type II receptor1PLO X
4780SL2 stem loop RNA from HIV-11F6U X
4781SL2 stem loop RNA from HIV-11F6U XX
4791HCV NS3 RNA helicase1JR6 X
4792ParD dimer2AN7 X
4797EqtII monomer1KD6 X
4798yeast frequenin1FPW X
4814Locust apolipophorin-III1LS4 X
4815CYTOTOXIN 21FFJ X
4816INFLUENZA A VIRUS PROMOTER RNA1JO7 X
4825Recombinant RC-RNase 21M58 X
4829Interleukin enhancer binding factor1JXS X
4833Antifungal protein from Streptomyces tendae Tu9011G6E X
4837CYTOCHROME C''1E8E X
4838bungarotoxin/Acetylcholine receptor peptide1L4W 1LJZ X
4841mSin3B-PAH2 complexed to Mad11E91 X
4845alpha-conotoxin Im1(R11E)1E74 X
4846alpha-conotoxin Im1(R7L)1E75 X
4847alpha-conotoxin Im1(D5N)1E76 X
4850GLUTAREDOXIN 31FOV X
4862[Ala31, Aib32]-NEUROPEPTIDE Y1FVN 1F8P X
4869NON HISTONE PROTEIN 6 A1LWM X
4872DESIGNED HETERODIMERIC LEUCINE ZIPPER1FMH X
4879Sortase1IJA X
4880calponin CH domain1H67 X
48841st LIM domain of PINCH protein1G47 X
4890CDK-ACTIVATING KINASE ASSEMBLY FACTOR MAT11G25 X
4891chinese cobrotoxin1G6M X
4892S100A4 dimer1M31 X
4893Recombinant RC-RNase 41KVZ X
4894MATERNAL EFFECT PROTEIN (STAUFEN)/RNA COMPLEX1EKZ XX
4895TmCsp1G6P X
4899SMN tudor domain1G5V X
4900C-terminal xylan binding module1HEH 1HEJ X
4902SH2 domain of Human Protein Tyrosine Kinase 61RJA X
4906C-terminal domain (44-84) of the inhibitor of F1 ATPase1HF9 X
4907Phospholamban (C41F)1FJP X
4910LEKTI domain one1HDL X
4911DYNEIN light chain 8 (dlc8) and nNOS (fragment peptide) complex1F96 X
4912DYNEIN1F3C X
4914vMIP-II1HFG 1HFN 1HFF X
4915Polyadenylate-binding protein 11G9L X
4916PITUITARY ADENYLATE CYCLASE ACTIVATING POLYPEPTIDE WITH N-TERMINAL 21 RESIDUES WITH AN AMIDATED C-TERMINUS1GEA X
4917Lipid Transfer Protein1BV2 X
4919ERp29 N-domain1G7E X
4920ERp29 C-domain2M66 X
4921PONERATOXIN1G92 X
4923omega-atracotoxin-Hv2a1G9P X
4924Tityustoxin K-alpha1HP2 X
4925N-Ada101EYF X
4927Circular Permuted Variant of CV-N1N02 X
4929Tctex1 dimer1XDX X
4930Human Trefoil Factor Family 1 protein homodimer1PS2 X
4933Human Trefoil Factor Family 1 protein1PS2 X
4935Signal Recognition Particle Protein SRP191KVV 1KVN X
4938mouse doppel1I17 X
4939ninth zinc-finger domain of the u-shaped transcription factor1FU9 X
4941Ku70 DNA binding domain at the C-terminus1JJR X
4945Vam3p N-terminal domain1HS7 X
4946C-1027 apoprotein1HZK X
4947C-1027 Apoprotein1HZL X
4948A-BUNGAROTOXIN/ NICOTINIC ACETILCHOLINE RECEPTOR MIMOTOPE COMPLEX1HOY X
4950HIV-1 Nef1QA4 X
4951HIV-1 Nef1QA5 X
4954Riboflavin Synthase N-domain1HZE 1I18 X
4957N-terminal domain of MotA, MotNF1I1S X
4958His6PSCD42NBI X
4959epsin ENTH domain1INZ X
4960methionine to histidine mutant of cyt c-5511FI3 X
4966Cardiotoxin A31I02 X
4972Crh1K1C X
4977lipid transfer protein1N89 X
4979Er-23 pheromone1HA8 X
4980bovine seminal ribonuclease monomer (N67D mutant)1QWQ X
4984CheW1KOS X
4988HUWENTOXIN-II1I25 X
4989B. subtilis ACYL CARRIER PROTEIN1HY8 X
4991thioredoxin like protein1ILO X
4993Zervamicin IIB1IH9 X
4994C domain of Cardiac Troponin C. complexed to EMD 570331IH0 X
4995GlyTM1bZip coiled-coil dimer1IHQ X
4996MTH8651IIO X
4997[Thr(B27)->Pro,Pro(B28)->Thr]-insulin1JCO X
5004human interleukin-131IK0 X
5006alpha-bungarotoxin1JBD X
5007VS RIBOZYME SUBSTRATE STEM-LOOP1HWQ 1J6Q X
5010DNA Polymerase X1JAJ X
5012the third domain of MMP-21J7M X
5018TUMOR NECROSIS FACTOR RECEPTOR-11ICH X
5020ION-SELECTIVE LIGAND D181I98 X
5021ION-SELECTIVE LIGAND A221I8E X
5022UMUD PROTEIN1I4V X
50235'-R(*GP*GP*UP*GP*CP*UP*UP*AP*GP*CP*AP*CP*C)-3'1I4C X
5024ALPHA-BUNGAROTOXIN1IDL X
5025ALPHA-BUNGAROTOXIN/ACETYLCHOLINE RECEPTOR PROTEIN (ALPHA CHAIN) COMPLEX1IDH X
5026CYTOCHROME C complexed with HEME C1I5T 1M60 X
5027human fibronectin EDA1J8K X
5028TRYPSIN INHIBITOR II1IB9 X
5030Honeybee antennal specific Protein 21TUJ X
5031KaiA N-terminus1M2E 1M2F X
5033Defensin Heliomicin1I2U 1I2V X
5034NOVISPIRIN-21HU7 1HU6 X
5036TRANSCRIPTION FACTOR SOX-51I11 X
5037OVISPIRIN-11HU5 X
5038HsUbc2b1JAS X
5041DNA Ligase III, BRCT domain (E.C.6.5.1.1)1IN1 1IMO X
5042Human lymphotactin monomer1J8I 1J9O X
5043Lamina-Associated Polypeptide 21H9F X
5044NEURAL CELL ADHESION MOLECULE1IE5 X
5046HCV IRES RNA DOMAIN IIIC1IDV X
5047LCCL module of human coch-5b2 protein1JBI X
5048cellular retinol-binding protein type I1JBH X
5049Extracellular domain of subunit 2 of the human receptor for type I interferons1N6U 1N6V X
5050Bungarus fasciatus IX1JC6 X
5051MTH16921JCU X
5052neurotoxin II1JE9 X
5053C-terminal domain of Pab1p1IFW X
5054Diadenosine 5',5'''-P1,P4 tetraphosphate hydrolase complexed with ATP1JKN X
5055HYPOTHETICAL PROTEIN HI02571IMU X
5059EC0051JE3 X
5060TM006 protein from Thermotoga maritima1JDQ X
5065CYSTEINE-RICH PROTEIN 21IBI X
5066metallothionein-31JI9 X
5070C-terminal domain of tyrosyl-tRNA synthetase1JH3 X
5071troponin C, skeletal muscle1JC2 X
5072CD3 Epsilon and gamma Ectodomain Fragment Complex1JBJ X
5073macrophage inflammatory protein 1-beta (MIP-1beta)1JE4 X
5074EMERIN1JEI X
5075Apolipoprotein(a) kringle IV type 61JFN X
5077M156R1JJG X
5078Lipoyl acid-bearing domain of human BCKD complex1K8O 1K8M X
5082Tc1 monomer1JLZ X
5083Epidermal-type fatty acid binding protein1JJJ X
5084PABC-Paip1 complex1JH4 X
5085PABC-Paip2 complex1JGN X
5086Hydrogenobacter thermophilus cytochrome c-5521AYG X
5091CYTOCHROME B51JEX X
5092beta2 subunit of BK channels1JO6 X
5094chemosensory protein1JJL 1K19 X
5096U-SHAPED TRANSCRIPTIONAL COFACTOR1JN7 X
5097bucandin1IJC X
5100Intramolecular complex of LMO2(LIM1) and ldb1(LID)1J2O X
5101ubiquitin fragment1GJZ X
5104MTH06371JRM X
5106MTH17431RYJ X
5108DapE : (Ace)IWG(Dnp)SGKLIETTA ANALOGUE OF HIV GP411JAA X
5109DabD (Ace)IWG(DAB)SGKLIDTTA ANALOGUE OF HIV GP411J9V X
5110HCYS BETA3-CYS ANALOGUE OF HIV GP411J8Z X
5111HSER (ACE)IWGC(BSE)GKLICTTA analogue of HIV GP411J8N X
5112PSI-CONOTOXIN PIIIF1JLP X
5113PSI-CONOTOXIN PIIIE1JLO X
5114KALATA B11JJZ 1K48 X
5115gamma subunit of dissimilatory siroheme-sulfite reductase1JI8 X
5116gamma subunit of dissimilatory siroheme-sulfite reductase1JI8 X
5117Rhodostomin2PJF X
5120mEGF/TGFalpha44-50 chimera1GK5 X
5122cyclic N-terminal domain of DnaB helicase1JWE X
5129MTH1880 without calcium1IQS 1IQO X
5130human lysozyme at 35 degree C1IY4 X
5131Second PDZ domain of PTP-BL1GM1 X
5134dAAUAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*UP*AP*AP*GP*CP*TP*AP*CP*G)-3'1JS7 1JS5 X
5135dAATAA DNA Bulge: 5'-D(*GP*CP*AP*TP*CP*GP*AP*AP*TP*AP*AP*GP*CP*TP*AP*CP*G)-3'1JRW 1JRV X
5136EDap (Ace)IWGESGKLI(DAB)TTA analogue of HIV GP411JDK X
5137DapD (Ace)IWG(DAP)SGKLIDTTA analogue of HIV GP411JD8 X
5138EDap (Ace)IWGESGKLI(DNP)TTA analogue of HIV GP411JCP X
5139DDap (Ace)IWGDSGKLI(DNP)TTA analogue of HIV GP411JC8 X
5140DDab: (ACE)IWGDSGKLI(DAB)TTA analogue of HIV GP411JAR X
5141SasA N-terminus1T4Z 1T4Y X
5142human lysozyme1IY3 X
5145human Doppel1LG4 X
5147metallothionein1JJD X
5148METHANE MONOOXYGENASE COMPONENT C1JQ4 X
5151IgG-binding (B1) domain of Streptococcal protein G1FD6 X
5152IMMUNOGLOBULIN G BINDING PROTEIN G1FCL X
5154N-terminal domain of Tissue Inhibitor of Metalloproteinases-11D2B X
5155p47 protein1JRU X
5157Antifreeze protein type 1 mutant1J5B X
5159Ran-binding domain 2 of RanBP21XKE X
5162SRm1601MP1 X
51645'-D(P*CP*CP*AP*TP*AP*AP*TP*TP*TP*AP*CP*C)-3' duplex1JUU X
5165Conserved Hypothetical Protein MTH15981JW3 X
5166hemolysin expression modulating protein Hha1JW2 X
5167AT-Rich DNA with the GAA-Hairpin Loop1JVE X
5169beta2-microglobulin1JNJ X
5170Histone mRNA1JU7 1JWC X
5171BPTI G37A, TRYPSIN INHIBITOR1JV9 1JV8 X
5172Oxidized cytochrome c553 from Bacillus pasteurii1K3G 1K3H X
5173Epiregulin monomer1K36 1K37 X
5174ARR101IRZ X
5175CPI-17 (35-120) deletion mutant1K5O X
5176Momordica Cochinchinensis Trypsin inhibitor II1HA9 X
5177chick cofilin1TVJ X
5178chitinase fibronectin type III domain1K85 X
5179vav n-terminal SH3 domain1K1Z X
5180GAL4 dimerization domain1HBW X
5181Xylanase 10A, second family 4 carbohydrate binding module1K45 1K42 X
5183BetaCore1K09 X
5184toxin BeKm from the scorpion Buthus eupeus1LGL 1J5J X
5185vascular endothelial growth factor receptor-binding domain dimer in complex with peptide v1071KAT X
5187TraR monomer1V4R X
5188paralytic peptide of Bombyx mori1IRR X
5189S100A11 homodimer1NSH X
5192neuropeptide F1K8V X
51935'-R(*GP*GP*UP*GP*CP*AP*UP*GP*GP*CP*AP*CP*C)-3'1JZC X
5194Synaptotagmin I1K5W X
5196Skeletal Dihydropydrine Receptor1JZP X
5199necrosis inducing protein1KG1 X
5201ION-SELECTIVE LIGAND A11I6Y X
5202CNP catalytic domain2ILX X
5203cysteine-rich domain of KSR1KBE 1KBF X
5204Calreticulin P-domain fragment 189-2611K9C X
5205Calreticulin P-domain fragment 221-2561K91 X
5206S100B dimer1UWO X
5207CALBINDIN D9K1KCY X
5208Palm-Thumb Domain of DNA Polymerase B1BPD 1BPE 1BPX 1BNP X
5209Palm-Thumb Domain of DNA Polymerase B in complex with XRCC1-NTD1BPD 1BPE 1BPX 1BNP 1XNT X
5210subgroup A Rous Sarcoma virus receptors PG800 and PG9501K7B X
5211SAP/SH2D1A bound to peptide n-Y-c1KA7 X
5212SAP/SH2D1A bound to peptide n-pY1KA6 X
5213CopZ from Bacillus subtilis1K0V X
5214Y2 selective analogue I of neuropeptide Y1D0W X
5215Y2 selective analogue II of neuropeptide Y1D1E X
5216Y2 selective analogue III of neuropeptide Y1D1F X
5217UvrC C-terminal domain1KFT X
5220Melanoma Inhibitory Activity Protein1K0X X
5225Parvulin 101JNS 1JNT X
5232Cdc13 DNA-binding domain /telomeric ssDNA complex1KXL XX
5236RCK41KN7 X
5238heparin-binding domain of vascular endothelial growth factor-1651VGH 2VGH 1KMX X
5241Thioredoxin1RQM X
5242prohormone convertase 1 pro-domain1KN6 X
52435'-D(*CP*AP*CP*TP*AP*CP*TP*CP*TP*TP*TP*GP*TP*AP*GP*TP*G)-3'1IR5 X
52455'-D(*TP*GP*TP*TP*TP*GP*GP*C)-3'1K1R X
5246Human insulin mutant1KMF X
52525'-D(*CP*CP*AP*CP*GP*CP*GP*TP*GP*G)-3'1KKV X
52535'-D(*CP*CP*AP*TP*GP*CP*GP*TP*GP*G)-3'1KKW X
5255WmKT1WKT X
5256Anticodon Stem-loop of tRNA(Phe)1KKA X
5257Thymosin beta-91HJ0 X
5259Anticodon Stem-loop of tRNA(Phe)1KKA X
5261Nuclease A Inhibitor1KTU 1J57 X
5262first fibronectin type II module of human matrix metalloproteinase 21KS0 1CK7 X
5264Human Beta-defensin 31KJ6 X
5265moricin monomer1KV4 X
5266FAT domain of Focal adhesion kinase (914-1053)1KTM X
5268tachystatin A1CIX X
5272Schistocerca gregaria chymotrypsin inhibitor1KGM X
5273Schistocerca gregaria chymotrypsin inhibitor variant L30R,K31M1KIO X
5275sialic acid binding domain of rhesus rotavirus VP41KRI 1KQR X
5276DIPETALIN1KMA X
5277PULMONARY SURFACTANT-ASSOCIATED PROTEIN B1KMR X
5278Pea Enation Mosaic Virus P1-P2 frameshifting pseudoknot1KPZ 1KPY X
5279cytochrome c71KWJ 1L3O X
52825'-D(*GP*CP*GP*AP*AP*GP*C)-3'1KR8 1PQT X
5283HIV-1 Vpr (34-51)1KZV 1KZT 1KZS X
5284A54 I-FABP1KZW X
5285T54 I-FABP1KZX X
5289third helix of Antennapedia homeodomain1KZ0 X
5290third helix[W6F,W14F] of Antennapedia homeodomain1KZ2 X
529112 amino acid long derivative of the third helix of Antennapedia homeodomain1KZ5 X
5292Trp-cage Construct 5b1L2Y X
5293Barstar pH 2.7 160 kD aggregate1BTA 1L1K X
5294beta subunit of translation initiation factor 21K8B 1K81 X
5297N-terminal DNA-binding domain of Rep protein from a geminivirus1L2M 1L5I X
5298PPIase monomer1L1P X
5299MITOTIC SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD2A/PEPTIDE1KLQ X
5301Leukosialin (CD43) fragment1KYJ X
5302Islet amyloid polypeptide1KUW X
5303nitrogen regulation protein NR(I)1KRX 1KRW 1J56 X
5304mono-heme c-type cytochrome ScyA1KX7 1KX2 X
5306hypoxia inducible factor-1alpha/p300 complex1L3E X
5308Human-E.coli chimeric thioredoxin1M7T X
5309Fusion of the LIM binding domain of Ldb1 and the N-terminal LIM domain of LMO41M3V X
5310phospholipase C gamma-1 C-terminal SH2 domain2PLD X
5312aIF2beta1NEE X
5315Protein Yfia1L4S X
5316gag1L6N X
5317Telomeric repeat binding factor 11ITY X
5318phospholipase C gamma-1 C-terminal SH2 domain2PLD X
5319cellular retinol-binding protein type I1JBH 1KGL X
5320B-FABP1JJX X
5321helix 6 of signal recognition particle RNA1L1W X
5323Thermal hysteresis protein isoform YL-1 (2-14)1L1I X
5326D24N61 mutant of ATP Synthase subunit c1L6T X
5327Hif-1alpha/CBP complex1L8C X
5328DNA Ligase BRCT domain1L7B X
5329C. elegans protein ZK652.31L7Y X
5330cellular retinol-binding protein type I1JBH 1KGL X
5331cellular retinol-binding protein type I1JBH 1KGL X
5332recoverin mutant, E85Q1JSA 1LA3 X
5333cytochrome c31IT1 2CDV X
5334NTD HTLV-I capsid protein1G03 X
5335YacG1LV3 X
5337human adrenodoxin1CJE X
5338IEGF-31L3Y X
53395'-D(*CP*GP*TP*AP*CP*G)-3'1K2K X
5340proapoptotic bid2BID X
5345LACTOSE OPERON REPRESSOR/DNA Complex1L1M XX
5346platelet aggregation inhibitor disintegrin1L3X X
5347RNase H domain of the HIV-1 reverse transcriptase1O1W X
5348ati monomer1IW4 X
5349Extended PBX Homeodomain-DNA complex1LFU XX
5353yeast Saccharomyces cerevisiae calmodulin1LKJ X
5354Human PAS Kinase PAS-A domain1LL8 X
5356GS-a3W protein1LQ7 X
5357tm11121LKN X
5361TELOMERE REPEAT BINDING FACTOR 1/DNA Complex1IV6 XX
5363hERR2-DNA complex1LO1 XX
5364Tap1GO5 X
5365myocyte nuclear factor2A3S 2D2W X
5366Vacuolar morphogenesis protein1KMD X
5369CREB Binding Protein1LIQ X
5370beta alanine linked polyamide bound to purine tract DNA1LEJ X
5371U6 RNA1LC6 X
5372CYTOCHROME C1LC2 1LC1 X
5375anneal10 21LD6 X
5376complex of transducin peptide and rhodopsin1LVZ X
5377Ca(2+)S100B-TRTK-12 peptide complex1UWO 2PRU X
5379PANCREATIC POLYPEPTIDE1LJV X
5381anneal2 31LD5 X
5383IP-101LV9 X
53858oxoG:G mismatch1N2W X
5386cNTnC-cTnI(147-162)-Bepridil Ternary Complex1LXF X
5387ubiquitin1G6J 1UBQ 1D3Z X
5389Yfia1N3G X
5390DNA-binding Protein H-NS1LR1 X
5392Upstream binding factor 11L8Y 1L8Z X
5394U2 snRNA - Intron duplex1LPW X
5395Unmodified U2 snRNA - Intron duplex1LMV X
5396ternary complex DHFR-trimethoprim-NADPH1LUD X
53983-methyladenine DNA glycosylase I1LMZ X
5399Erg Pointed Domain1SXE X
5401GABPalpha Pointed Domain1SXD X
5403trp RNA-binding attenuation protein undecamer1C9S 1GTF 1GTN X
5405peptide n31M25 X
5407cytochrome c maturation protein E1LM0 X
5409PTB1-121QM9 X
5410obtustatin1MPZ X
5454motilin1LBJ X
5457complex of hMad1-Sin Interacting Domain (SID) and PAH2 domain of mSin3B1E91 1PD7 X
5459EL5 RING-H2 finger domain1IYM X
5461Interleukin-2 tyrosine kinase src homology 2 domain1LUI 1LUK 1LUM 1LUN X
5463catestatin1LV4 X
5464Monocytic leukemia zinc finger protein1M36 X
5465SAPOSIN C1M12 1SN6 X
5466Cytochrome c, iso-11LMS X
5467ADAP1RI9 X
5469omsvp3 monomer1IY5 X
5470p14c/n39c monomer1IY6 X
5472Ovomucoid Third Domain1M8B 1M8C X
5473Ovomucoid Third Domain1M8B 1M8C X
5475plastocyanin synechocistys PCC 68031M9W X
5480Calmodulin-olfactory channel peptide complex1SY9 X
5481Hub11M94 X
5482DC 45-1501MJD X
5485ribosomal protein L30e1GO0 X
5486Tachyplesin I1MA2 1MA4 1MA5 1MA6 X
5487Tachyplesin I, tyrosine mutant1MA2 1MA4 1MA5 1MA6 X
5488Tachyplesin I, phenylalanine mutant1MA2 1MA4 1MA5 1MA6 X
5489Tachyplesin I, alanine mutant1MA2 1MA4 1MA5 1MA6 X
5491scarabaecin monomer1IYC X
5494PW2 Bound to SDS Micelles1M02 X
5495psalmotoxin11LMM X
5498p67SH3(C) and p47 tail peptide1K4U X
5499AMPA receptor interacting protein1M5Z X
5500parkin ubiquitin-like domain1IYF X
5501Hepcidin1M4F X
5502Hepcidin1M4E X
5503Human centrin21M39 X
5506double module1NWV X
5511p21 Rac1 GTPase1FOE 1G4U 1HE1 1HH4 1I4D 1I4T 1E96 X
5516Coxsackievirus and Adenovirus receptor1RSF X
5517B-MybR2R31A5J XX
5525Tristetraproline1M9O X
5527Huwentoxin-IV1MB6 X
5528RNA (25-MER):the complementary RNA promoter of influenza a virus1M82 X
5529Monellin chain B and Monellin chain A1M9G X
55305'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP*AP*GP*AP*UP*(5MC)P*UP*GP*G)-3'1LUX X
55315'-R(*CP*CP*AP*GP*AP*(OMC)P*UP*(OMG)P*AP*AP*(1MG)P*AP*UP*(5MC)P*UP*GP*G)-3'1LUU X
5532Tumor Susceptibility gene 101 protein/Gag Polyprotein1M4P 1M4Q X
5535R3H domain1MSZ X
5536G88W110 fragment of Staphylococcal Nuclease1RKN X
5538PWWP domain1H3Z X
5542Penetratin1OMQ X
5544Ca2+-loaded S100B(beta beta)-TRTK-12 peptide complex1MWN 1B4C 1DT7 1QLK X
5545insulin-like growth factor binding protein-61RMJ X
5551LEKTI domain 6 (HF7665) monomer1H0Z X
5552DUAL SPECIFICITY PROTEIN PHOSPHATASE 2 (E.C.3.1.3.48)(E.C.3.1.3.16)1M3G X
5553C4 promoter of influneza A virus1MFY X
5554N-WASP EVH1 Domain-WIP complex1MKE X
5555Chromodomain helicase-DNA-binding protein 41MM2 X
5556PHD WSTF1MM3 X
5557CrcA protein1MM4 1MM5 X
5558Sp100b SAND domain1H5P X
5560TM1290 conserved hypothetical protein1RDU X
5561Activation domain of human procarboxipeptidase A21O6X X
5562CCGCGG1N1K X
5564kinase associated protein phosphatase kinase interaction domain1MZK X
5565porcine MSP1XHH X
5566Phosphotyrosine binding domain of Shc1N3H X
5567Histone H3 Lysine Methyltransferase from Paramecium Bursaria Chlorella Virus 11N3J X
5570DR00791Q27 X
5574KASSININ1MYU X
5575Eledoisin1MXQ X
5576nbd-min0011MO8 X
5577sodium/potassium-transporting ATPase alpha-1 chain (E.C.3.6.3.9)1MO7 X
5578rat cellular retinol-binding protein I, bound to all-trans retinol1MX8 X
5579rat cellular retinol-binding protein I, ligand free1MX7 X
5580Type B lantibiotic mersacidin1MQZ X
5581Type B lantibiotic mersacidin1MQX X
5582Type B lantibiotic mersacidin1MQY X
5583MHC CLASS II-ASSOCIATED P41 INVARIANT CHAIN FRAGMENT (P41icf)1L3H X
5585alpha-conotoxin GID1MTQ X
55865'-R(*GP*GP*CP*(P5P)P*AP*GP*CP*CP*U)-3'1MV1 X
55875'-R(*GP*GP*CP*AP*(P5P)P*GP*CP*CP*U)-3'1MV2 X
55885'-R(*GP*GP*CP*(P5P)P*(P5P)P*GP*CP*CP*U)-3'1MV1 X
5589VC04241NXI X
5596yggu1N91 X
5597cytochrome c1N9C X
5598receptor associated protein-domain 11OV2 1OP1 X
5599Human Prolactin1RW5 X
5601rubredoxin1ZRP X
5604ZNTA (E.C.3.6.3.3/E.C.3.6.3.5)1MWY 1MWZ X
5607Human Neuronal Glycine Receptor alpha-1 Chain TM21MOT X
5608Contryphan-Vn1NXN X
5609kalata B11N1U X
5610C terminus of rat striated muscle alpha tropomyosin encoded by exon 9a1MV4 X
5611Neurokinin A1N6T X
5612floral defensin-like protein 11N4N X
5613bhpW, disulfide cyclized beta-hairpin peptide1N09 X
56145'-R(*GP*GP*CP*AP*AP*GP*CP*CP*U)-3'1MUV X
5616WW domain pair of S.cerevisiae pre-mRNA processing protein 401O6W X
5617Bowman-Birk inhibitor from snail medic seeds (Medicago Scutellata) (MSTI)1MVZ X
5620ribosomal protein S28E1NE3 X
5621yoag ecoli1NEI X
5622Thioredoxin-like Protein from Methanobacterium Thermoautotrophicum1NHO X
5624translation initiation factor IF21ND9 X
5625cytochrome c31A2I 2CTH 2BPN X
563199-mer peptide of densin-180-like protein/phage-derived peptide1N7T X
5632telomerase RNA p2b hairpin1NA2 X
5633MOLT-INHIBITING HORMONE1J0T X
5652CnErg11NE5 X
5653MIH1J0T X
5654Immunoglobulin G binding protein G1MPE X
5655U80G U6 ISL RNA1NC0 X
5657Methanobacterium thermoautotrophicum1NR3 X
5659Human Rhinovirus-14 3C Protease monomer2IN2 X
5660oxidized cytochrome c1AKK X
5664oxytetracycline acyl carrier protein1NQ4 X
5667First zinc finger of Zinc finger protein 2651N0Z X
56683-methyladenine DNA glycosylase I1NKU X
5669Npl4 Zinc Finger domain1NJ3 X
5670Hellethionin D1NBL X
56715'-D(*CP*GP*CP*GP*AP*AP*TP*TP*CP*GP*CP*G)-3'1NAJ X
5672Neurotoxin 51NH5 X
5673Glucagon analogue1NAU X
5674HAINANTOXIN-IV1NIY X
5675HAINANTOXIN-I1NIX X
5676Pandinus imperator potassium channel blocking toxin 41N8M X
5677focal adhesion targeting domain of focal adhesion kinase1K05 1K40 1KTM X
5678HNF6 protein1S7E X
5681CYCLIC OLIGONUCLEOTIDE D(CGCTCATT)1N96 X
5683QR61NWB X
5688cathelin-like domain of the protegrin-3 precursor1N5P 1N5H X
5689Pheromone Binding Protein from Antheraea polyphemus1QWV 1TWO X
5690cobra neurotoxin II1NOR 1JE9 X
569130S ribosomal protein S28E1NY4 X
5694chignolin1UAO X
5695YHR087W gene product1NYN X
5696ZASP-PDZ Domain1RGW X
5698C-terminal domain of poly(A)-binding protein1NMR X
5701SopE2 momomer1R9K 1R6E X
5702Omega-atracotoxin-Hv1a1AXH X
5705UUCG tetraloop2KOC X
5706TipAS1NY9 X
5708PTS system, glucose-specific IIA component (E.C.2.7.1.69)1O53 X
5710Mth11 free in solution1OQK X
5713human prion protein1HJM X
5714Synthetic DNA duplex with an AG mismatch1ONM X
5716CK14 DNA 14-MER DUPLEX1K8J 1K8N 1K8L X
5717XBY6 DNA 14-MER DUPLEX1K8J 1K8N 1K8L X
5718XBY2 DNA 14-MER DUPLEX1K8J 1K8N 1K8L X
5719La protein1S79 X
5720Adenylate Kinase from Escherichia coli1AKE X
5722complex between Ca2+/C-terminal domain of caltractin and 19-resiude peptide from Kar1p1OQP X
5729C-terminal SH3 domain of SEM-5 from C. elegans1KFZ 1K76 X
5730Benzo[a]Pyrene Adducted Adenine in a DNA duplex1N8C X
5735rat amyloid beta-peptide 1-281NMJ X
57375'-D(*TP*TP*AP*GP*GP*GP*T)-3'1NP9 X
5738Tropinin C and I complex1NPQ X
57395'-D(*AP*CP*AP*TP*CP*XP*AP*TP*CP*T)-3'1N1N X
5742COX assembly protein1ON4 X
5744human alpha-synuclein1XQ8 X
5745bovine microsomal cytochrome b51HKO X
5746Adenylate Kinase from Escherichia coli1AKE X
5747Homodimeric Alpha2 Four-Helix Bundle1NVO X
5748p270 or Human SWI11RYU X
5750BLyS Receptor 31OSX X
5753Genome polyprotein [Core protein P3A]1NG7 X
5757Crh dimer1K1C X
5758YqgF1OVQ X
5764ALY1NO8 X
5765fifth transmembrane segment (residue L758 to E785) of sarcoplasmic reticulum Ca2+-ATPase1SU4 X
5766DNA polymerase lambda (E.C.2.7.7.7)1NZP X
5767Viscotoxin C11ORL X
5768Potential copper-transporting ATPase1OQ6 X
5769Potential copper-transporting ATPase1OQ3 1OPZ X
5770Ca2+/calmodulin-glutamate decarboxylase peptide complex1NWD X
5771tff3 dimer1E9T 1PE3 X
5773HIV-1 STEM LOOP SL1 MONOMERIC RNA1N8X X
57755'-R(*AP*AP*AP*GP*GP*AP*GP*GP*A)-3'/5'-D(*CP*CP*UP*CP*CP*UP*U)-3'1NTQ XX
5776sPrODN1:RNA1NTS XX
5777PODN:RNA1NTT XX
5779HYPOTHETICAL PROTEIN HI14501NNV X
5780apoptosis-associated SPECK-like peotein containing a CARD1UCP X
5781Propynyl DNA.RNA hybrid1OO7 XX
5785Matrix MetalloProteinase-3 in complex with N-TIMP-11OO9 X
5786Neural cadherin1OP4 X
5787RC-RNase 31Z5F X
5790Hypothetical protein AQ 18571NWB X
5791Lactose operon repressor1OSL XX
5796MPN1561PA4 X
5798Protein yrbA1NY8 X
5801T1E1P9J X
5807gpD1VD0 X
5808PAH2-SID24 complex1PD7 X
5813Potential copper-transporting ATPase1P6T X
5815Major coat protein1NH4 X
5817Neurogenic locus notch homolog protein 11PB5 X
5818YbcJ1P9K X
5820Thiopurine Methyltransferase1PJZ X
5821RPA70(181-291) ssDNA binding domain1JMC X
5822RPA70(299-422) ssDNA binding domain1JMC X
5823RPA70(181-422) ssDNA binding domains1JMC X
5824KaiA C-terminal domain1Q6A 1Q6B X
5833mob11R3B X
5834HIV-1 frameshift inducing stem-loop RNA1PJY X
5836Yersinia pseudotuberculosis-derived mitogen1POQ X
5839GB32IGD 2IGH X
5841kinase associated protein phosphatase, kinase interaction domain1MZK X
5842IR241Q48 1R9P X
5843expressed protein: At3g17210.11Q53 X
5844ZR182M6Q 2M8W X
5845MW2441 protein1R57 2H5M X
5847Sda1PV0 X
5848S-locus pollen protein1UGL X
5849COP9 complex subunit 41UFM X
5850protein tyrosine phosphatase (E.C.3.1.3.48)1P8A X
5851Kruppel-like factor 31P7A X
5852A mimic of the VS Ribozyme Hairpin Substrate1OW9 X
5859Microcin J251PP5 X
5860Subtilosin A1PXQ X
5861gtpase domain MnmE1RFL X
5864Neurokinin B1P9F X
5865K+ toxin-like peptide1PVZ X
5866Mutator mutT protein (E.C.3.6.1.-)1PPX X
5867INTERSECTIN 21UHF X
5868UV excision repair protein RAD23 homolog B1PVE X
5869Alpha-A-conotoxin EIVA1PQR X
5873BlaI N-terminal domain1P6R 2P7C X
5874p47 monomer1JRU 1VAZ X
5875The B1 Domain of Streptococcal Protein G1Q1O X
5876p47 monomer1JRU 1V92 X
5877Bacteriophage Pf1 major coat protein1PJF 1ZN5 X
5878region 1463-1617 of mouse 53BP11SSF X
5879S.typhi type IVb pilin1Q5F X
5880product of RIKEN cDNA 3110009E221UHU X
5881SmIIIA1Q2J X
5882C1q trimer2OII 2KA3 X
5885DIMER OF FUSED DOCKING DOMAINS OF DEBS2 AND DEBS31PZQ 1PZR X
5891Sso10a1XSX X
5892Sso10b22A2Y X
5899Sporulation initiation phosphotransferase F1PUX X
5900complement receptor type 11PPQ X
5901neural zinc finger transcription factor 11PXE X
5902Hath domain of hepatoma-derived growth factor (hHDGF)1H3Z 1RI0 2NLU X
5903CD44 hyaluronan-binding domain2I83 X
5905Sac7d1SAP 1AZP 1AZQ 1C8C 1CA5 1CA6 X
5907Ku80 CTD1RW2 X
5908Sac7d V30I monomer1SAP 1AZP 1AZQ 1C8C 1CA5 1CA6 X
5909Sso7d monomer1BBX 1BF4 1BNZ 1C8C 1CA5 1CA6 1JIC 1SSO X
5910Sso7d monomer1BBX 1BF4 1BNZ 1C8C 1CA5 1CA6 1JIC 1SSO X
5911PNC271Q2I 1Q2F X
5912ATP-dependent DNA helicase II, 80 kDa subunit1Q2Z X
5913Neurotoxin Cn111PE4 X
5914Met-enkephalin1PLX X
5915Met-enkephalin 11PLW X
5917translation1Q8K X
5919Loop E of 5S rRNA from spinach chloroplasts1MNX X
5920PrrA C-terminal domain1UMQ X
5922Potassium voltage-gated channel subfamily H member 21UJL X
5923T22G mutant of the N-terminal SH3 domain of the Drosophila protein drk2A37 X
5924FAT domain of Focal adhesion kinase (920-1053)1QVX X
5925SH2-SH3 adapter protein drk2A36 X
5926Rubredoxin1RWD X
59275'-D(*CP*GP*CP*TP*AP*AP*CP*AP*GP*GP*C)-3'1PQQ X
5928enth-vhs domain1VDY 2DCP X
5929hypothetical rhodanase domain1VEE 2DCQ X
5932DKC mutant P2b telomerase RNA1Q75 X
5933Ste11 Regulatory Domain1X9X X
5934f-MLF peptide1Q7O X
5935fructose-2,6-bisphosphatase1TIP 1BIF X
5937PDZ2b domain of PTP-Bas (hPTP1E)1Q7X X
5938CP-11in DPC micelles1QXQ 1QX9 1G89 X
5939Spred2 EVH1 domain2JP2 X
5940third domain of the interleukin-6 receptor2ARW X
5941cycloCP-11in DPC micelles1QXQ 1QX9 1G89 X
5944CD4 cytoplasmic tail - Lck N terminus1Q68 X
5945CD8a cytoplasmic tail - Lck N terminus1Q69 X
5946afaD-dsc2FVN X
5947donor strand complemented AfaE-III1RXL X
5948Disintegrin kistrin, AKGDWN Mutant1Q7J X
5949Disintegrin kistrin, ARGDWN Mutant1Q7I X
5950Cell division Activator CedA2BN8 X
5956Max*VL homodimer1R05 X
5958MAP-LC3 monomer1V49 X
5960myristoylated HIV-1 matrix2H3Q X
5961complement type repeats 5 and 6 from LRP2FYJ 2FYL X
5962wildtype domain 5 of the ai5gamma group II intron1R2P X
5963hypothetical protein hi17232APN X
5964headpiece subdomain1UNC X
5965headpiece subdomain1UNC X
5966headpiece subdomain1UND X
5967HIV-1 protease (E.C.3.4.23.16)1Q9P X
5968dematin1QZP X
5969holo-neocarzinostatin1O5P X
597050S Ribosomal Protein L181OVY X
5971Domain III of the E protein of Langat flavivirus1Z66 X
5972ProP antiparallel coiled-coil1R48 X
5975N-terminal domain of trout cardiac troponin C1R2U 1R6P X
5977TM14921R73 X
5978HCV NS5A N-terminal1R7C 1R7D 1R7E 1R7F 1R7G X
5979DNA1R2L X
5981ternary complex of human DHFR with trimethoprim and NADPH1YHO X
5985alpha-Conotoxin GIC1UL2 X
5986paralytic peptide of Antheraea yamamai1V28 X
5987CBP TAZ1 domain and CITED2 CAD1R8U X
5988alpha-bungarotoxin/ nicotinic acetylcholine receptor mimotope complex1RGJ X
5989Cytotoxin I5NPN X
5991Murine Ets-1 deltaN3011R36 X
5992C-terminal domain of human centrin 2-Ca2+ - P1-XPC Peptide Complex2A4J X
5994Orexin-A1R02 1WSO X
5998ApaG/CorD protein2F1E X
6001C5 C345C domain1XWE X
6002p63 monomer1RG6 X
6004Cofilin, non-muscle isoform1Q8G X
6005TIS11d TZF/ 5'-UUAUUUAUU-3' complex1RGO XX
6006CCAP1V46 X
6007tn3 calcium free form1RJH X
6009Thrombin-binding DNA aptamer1RDE X
6010tm09791RHX X
6011At5g225801RJJ X
6012Sgt1 CS domain1RL1 X
6014matrilysin2DDY X
6015cC1 domain2AVG X
6017S100C/A11 fragment1V4Z X
6018phosphorylated S100C/A11 fragment1V50 X
6020Polyphemusin I1RKK X
6022Copper-transporting ATPase 11Q8L X
6024Beta-lactamase TEM1ERO 1ERM X
6027Mu-conotoxin PIIIA1R9I X
6028ribosomal protein S17E1RQ6 X
6029Type IA potassium translocating ATPase B chain1SVJ 1U7Q 2A29 X
6030Type IA potassium translocating ATPase B chain2A29 X
6032Coactosin (Mus musculus)1WM4 X
6034ear-domain of alpha-adaptin C1QTS X
6037potassium channel toxin KX1RJI 1WT8 X
6038Small inducible cytokine B111RJT X
6039BOC-(D-NLE-L-NLE)4-D-NLE(METHYL)-L-NLE-D-NLE-L-NLE METHYL ESTER1R9V X
6040Pulmonary surfactant-associated protein B1RG3 1RG4 X
6041c-RW1QVL 1QVK X
604230mer stemloop-D of coxsackieviral RNA1RFR X
6043Pseudoazurin2P80 X
6044La protein1S7A X
6045pfr13 monomer1S04 X
6046West Nile Virus I, strain 385-99, Domain III1S6N X
6047Organomercurial Lyase1S6L X
6049Parvalbumin alpha1RK9 X
6052HR9691SGO X
6053the N-terminal 16kDa domain of Ada Protein1ADN X
6054the methylated N-terminal 16kDa domain of Ada Protein1ADN X
6056Yeast oligosaccharyltransferase subunit Ost4p1RKL X
6058Hypothetical Archaeglobus fulgidis protein AF20951RZW X
6059Nore11RFH X
6060PDZ2 from PTP-BL1GM1 1VJ6 X
6062NRS231S34 1S2F X
6063E6apc2 peptide1RIM X
6064E6apc1 peptide1RIK X
6066K27A Hainantoxin-IV1RYV X
6067K27A Hainantoxin-IV1RYG X
6068Peptide YY1RUU 1RU5 X
6069Precarnobacteriocin B21RY3 X
6070Endothelin-11V6R X
6072Protein inhibitor of activated STAT protein 11V66 X
6073Hypothetical superoxide dismutase-like protein yojM1U3N X
6075arsenate reductase monomer1Z2E 1Z2D X
6076stem-loop RNA1R7W X
6077stem-loop RNA1R7Z X
6079thioredoxin h1 from poplar1TI3 X
6081troponin C2JNF X
6082methionine-rich 2S albumin from Sunflower seed1S6D X
6083SheepPrP(135-155)1S4T X
6084dh434(0-63)1SQ8 X
6085hepcidin1S6W X
6088E6apn1 peptide1RIJ X
6089Lipid transfer protein 11SIY X
6090methionine sulfoxide reductase A2GT3 X
6091PDZ2 from PTP-BL1GM1 X
6092PDZ2 from PTP-BL1GM1 X
6093CD44 antigen1POZ X
6095CBP KIX domain and c-Myb1SB0 X
6096Dynein light chain 1, cytoplasmic1RHW X
6101BOC-L-NLE-(D-NLE-L-NLE)5-D-NLE(METHYL)-L-NLE-D-NLE-L-NLE METHYL ESTER1S1O X
6102Hypothetical UPF0250 protein ybeD1RWU X
6103Calcium-dependent protein kinase SK5 (E.C.2.7.1.-)1S6J X
6104Calcium-dependent protein kinase SK5 (E.C.2.7.1.-)1S6I X
6105HCO-(D-Nle-L-Nle)3-D-MeNle-L-Nle-D-Nle-L-Nle-OMe1S4A X
610660S acidic ribosomal protein P21S4J X
610760S acidic ribosomal protein P21S4H X
6108Glycogen synthesis protein glgS1RRZ X
6109Scorpion toxin BmKK41S8K X
6110mutant of LEKTI domain 11UUC X
6111Choristoneura fumiferana antifreeze protein isoform 5011Z2F X
6114BRCTc domain1OQA X
6120Hypothetical protein CC17361T17 X
6121CUG-BP2DHS X
6122S1 monomer1SLJ 1SMX X
6123Truncated hevein of 32 aa1HEV 1Q9B 1T0W X
6126CG5884-PA1RY4 X
6127p1 encoded protein1SE7 X
6128At3g01050.11SE9 X
6129Copper-transporting ATPase 1 (E.C.3.6.3.4)1S6U X
6130Copper-transporting ATPase 1 (E.C.3.6.3.4)1S6O X
6131Cytochrome b51SH4 X
6134d27gg1SA8 X
6135Mu-O-conotoxin MrVIB1RMK X
6137proBnIb monomer1SM7 X
6138At2g249401T0G X
6139Oela europea pollen allergen ole e 61SS3 X
6150fatty acid binding protein2POA X
6151Transportan in bicellar solution with [DMPC]/[DHPC]=0.331SMZ X
6152TUMOR INHIBITORY PROTEIN1SJ6 X
6154tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)1VD9 X
6155tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)1VDA X
6156tandem repeat 1 of fibroin-modulator-binding-protein-1(residues 99-121)1VDB 1VD7 X
6157tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)1VD8 X
6158saposin C1SN6 X
6159DdCAD-1 monomer2B1O X
6160somatomedin B domain of vitronectin monomer1SSU X
6161Yeast linker histone globular domain I1UST X
6162Yeast linker histone globular domain II1USS X
6165Hepatocyte growth factor receptor1SSL X
6166Gamma-aminobutyric acid type B receptor1SS2 X
6167Nucleobindin1SNL X
6168cyclic hexapeptide RR(NAL)(NAL)RF1SKL X
6169cyclic hexapeptide KKWWKF1SKK X
6170cyclic hexapeptide RRYYRF1SKI X
6171Gamma-aminobutyric acid type B receptor, subunit 11SRZ X
6172apo ScAtx11SB6 X
6173PfR482LP6 X
6175F-spondin TSR domain 11SZL X
6176Ubiquitin-like domain of tubulin-folding cofactor B1T0Y X
6177Polypyrimidine tract-binding protein 1 domain 21SJR X
6178Polypyrimidine tract-binding protein 1 domain 11SJQ X
6179LEKTI Domain 15 short1UVF X
6180LEKTI Domain 151UVG X
6185Regulatory protein cro1RZS X
61865'-D(P*TP*GP*AP*TP*CP*A)-3'1SY8 X
6187hypothetical protein PF10611SF0 X
6188Acyl-CoA-binding protein1ST7 X
6189NSFL1 cofactor p471SS6 X
6190Cytochrome C oxidase assembly protein ctaG1SP0 1SO9 X
6191SecA1SX1 1SX0 X
6192Omega-atracotoxin-Hv1a1AXH X
6194Omega-atracotoxin-Hv1a1AXH X
6197Src homology-3 domain2BTT X
6198TM1816 monomer1T3V X
6200MCRD 11SP7 X
6201Ca.CD21T6W X
6203insulin analogue1T1P X
6204insulin analogue1T1K X
6205insulin analogue1T1Q X
6208hr532 monomer1TUZ X
6209N-domain of At3g03410.11TIZ X
6211Carnobacteriocin B2 immunity protein1TDP X
6216Zinc finger protein ZFPM11SRK X
6217Cytotoxic linear peptide IsCT1T55 X
6218Cytotoxic linear peptide IsCT1T54 X
6219Cytotoxic linear peptide IsCT1T52 X
6220Cytotoxic linear peptide IsCT1T51 X
6221RpfBc1XSF X
6222Kurtoxin1T1T X
6225Tfb12GS0 X
6226EW29 monomer2RST X
6227Barstar1BTA X
6231hPAP2GO0 X
6233(poly)ubiquitin-binding region of the proteasome subunit S5a1YX6 1YX5 1YX4 X
6235SNARE complex2N1T X
6236APP7701TKN X
6238ZZ domain of CBP1TOT X
6241josephin domain of ataxin-31YZB X
6244Mycoplasma Genitalium gi38449381TM9 X
6245Gastric inhibitory polypeptide1T5Q X
6246daptomycin1T5M X
6247NifU11TH5 X
6248MDM21TTV X
6254HPr monomer1TXE X
6259GatB monomer1TVM X
6260IAAL-E3/K3 heterodimer1U0I X
6261SH3 domain of Lyn Tyrosine Kinase1W1F X
6262CG4244-PB1TK7 X
6263Rubredoxin1SPW X
6264Cryptdin-41TV0 2GW9 X
6265armadillo repeat and U-box containing protein1T1H X
6266Copper transport protein ATOX11TL4 X
6268CBP TAZ11U2N X
6269chPrP (128-242)1U3M X
6272MTH07761Z9V X
6282turtle PrP monomer1U5L X
6284DnaG-C2HAJ X
6285talin 755-8891U89 X
6286SMRT deacetylase activation domain1XC5 X
6287GABPalpha pointed domain1SXD X
6289SecA Ct1TM6 X
6290Nc metallothionein1T2Y X
6293tandem repeat 2 of fibroin-modulator-binding-protein-1(residues 122-144)1WNM X
6294tandem repeat 4 of fibroin-modulator-binding-protein-1(residues 168-190)1WNN X
6295flavin domain of methane monooxygenase reductase1TVC X
6296tandem repeat 3 of fibroin-modulator-binding-protein-1(residues 145-167)1WNK X
6298ASF1 anti-silencing function 1 homolog A1TEY 2IIJ X
6299alpha 1 type II collagen isoform 11U5M X
6300Kalirin1U3O X
6301DESIGNED HETERODIMERIC LEUCINE ZIPPER1U2U X
6302Four-helix bundle model1U7M X
6303Four-helix bundle1U7J X
63075'-D(*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*G)-3'1U64 X
6311Spry domain-containing SOCS box protein 22AFJ X
6312flp monomer1W7D X
6313Pheromone-binding protein1LS8 1GM0 1XFR X
6315TcUBP11U6F X
6317CylR2 dimer2GZU X
6318Thioredoxin h11XFL X
6320U6 extended ISL1XHP X
6321delta25-PYP1XFN X
6322delta25-PYP1XFQ X
6324hypothetical protein TM09791X9A X
6325CREB Binding Protein (E.C.2.3.1.48)1WO7 X
6326CREB Binding Protein1WO6 X
6327CREB Binding Protein (E.C.2.3.1.48)1WO5 X
6328CREB Binding Protein (E.C.2.3.1.48)1WO4 X
6329CREB Binding Protein (E.C.2.3.1.48)1WO3 X
6330AP4A hydrolase monomer1XSA X
6331SH2 domain1WQU 2DCR X
6333ABA-1A with oleic acid2XV9 X
6335redox-switch domain of Hsp331XJH X
6336AP4A hydrolase with ATP1XSB 1XSC X
6337AAH269941XO3 X
6338At1g775402EVN X
6339AT1g01470 monomer1XO8 X
6341At3g04780.11XOY X
6342survivin dimer1XOX X
6343PA1324 (21-170)1XPN X
6344HR19581XPW X
6347MTx-HsTx11WPD X
6349LH1 alfa polypeptide1XRD X
6350LH1 Beta polypeptide1WRG X
6354N-terminal domain of NECAP1 protein1TQZ X
6355SE09361XHJ X
6356Yeast Frataxin homolog 1 protein2GA5 X
6357Beta-lactamase TEM1ERO 1ERM X
6358Xcc975 monomer1XS3 X
6359YGGX1XS8 X
6362NifU-like protein1XJS 2AZH X
6365Protein BC47091XN6 X
6366Hypothetical protein yqbG1ZTS X
6367Hypothetical protein yhgG1XN7 X
6369Protein BH15341XN5 X
6370Toxin APETx11WQK X
6374AIRE1-PHD11XWH X
6376TgMIC1-CT2BVB X
6377fPrP monomer1XYJ X
6378canine prion protein1XYK X
6380pig prion protein monomer1XYQ X
6381ovPrP,H168 monomer1XYU X
6382prion protein1XU0 X
6383eprp monomer1XYW X
6384Tumor necrosis factor receptor superfamily member 13B1XUT X
6386aei monomer1Y1B X
6387aei-analogue monomer1Y1C X
6388Penaeidin-4d1XV3 X
6389BuTX-MTX1WT7 X
6390R-module2AGM X
6392human TSG-61O7B X
6393human TSG-61O7C XX
6395DivIB monomer1YR1 2ALJ X
6396BC0291721Y4O X
6398Sulfolobus solfataricus acylphosphatase1Y9O X
6399TPR domain in p67phox1HH8 X
6400wt ma2F76 X
6401R55F2F77 X
6402CsrA dimer1Y00 X
6403Ovine Prion Protein Variant R1681Y2S X
6407HPV16 E6 C-terminal domain2FK4 X
6410grx11Z7R 1Z7P X
6416apo-NikA1UIV X
6419Variant surface glycoprotein MITAT 1.21XU6 X
6420Daptomycin1XT7 X
6421sst1-selective somatostatin (analog 5)1XXZ X
6422sst1-selective somatostatin (analog 1)1XY4 X
6423sst1-selective somatostatin (analog 1)1XY5 X
6424sst1-selective somatostatin (analog 1)1XY6 X
6425sst1-selective somatostatin (analog 1)1XY8 X
6426sst1-selective somatostatin (analog 1)1XY9 X
6427Antifreeze peptide SS-31Y03 1Y04 X
6434gpU1Z1Z X
6437lf11 peptide2GMD 2GMC X
6438CikA C-terminus2J48 X
6443At5g016101YDU X
6444MMP121YCM 1Z3J X
6446Sodium/hydrogen exchanger 11Y4E X
6447Major vault protein1Y7X X
6448Hypothetical UPF0131 protein ytfP1XHS X
6454sdia2AVX X
6456SH3 domain of Lyn Tyrosine Kinase with a herpesviral ligand1WA7 X
6457Ubiqutin assembly2MOR X
6459Itch WW3 domain1YIU X
6462Lactotransferrin1Y5C X
6463LfcinB4-14Disu1Y58 X
6464At1g166401YEL X
6465pal-uyp2AIZ X
6467APETx21WXN X
6468mitogen-activated protein kinase p38 alpha2LGC X
6474KI-FHA domain of KAPP1MZK X
6475Man5C CBM35 Mannan Binding Module2BGO 2BGP X
6476GII loop mutant, GII-L1YQA X
6477Telomerase RNA P2b-P3 pseudoknot1YMO X
6478Transition state regulatory protein abrB1YFB X
6479Excisionase from transposon Tn9161Y6U X
6480Copper-transporting ATPase 1(E.C.3.6.3.4)1YJV X
6481Copper-transporting ATPase 1(E.C.3.6.3.4)1YJU X
6482Copper-transporting ATPase 1(E.C.3.6.3.4)1YJT X
6483Copper-transporting ATPase 1(E.C.3.6.3.4)1YJR X
6484S100A132CXJ X
6489F1Fo-ATP synthase subunit c1WU0 X
6493URNdesign2A3J X
6498Siah-Interacting Protein (Residues 1-77)1YSM X
6499distinctin chain A/distinctin chain B1XKM X
6505hypothetical protein MM13571YEZ X
6506Conkunitzin-S12CA7 X
6507Histone acetylatransferase PCAF1WUM 1ZS5 X
6508Histone acetylatransferase PCAF (E.C.2.3.1.48)1WUG 1ZS5 X
6509ScYLV RNA pseudoknot1YG3 1YG4 X
6510AMA1 Domain II1YXE X
6511peptide SD1YT6 X
6516holo-acyl carrier protein2FQ2 2FQ0 X
6519Calsensin1YX8 1YX7 X
6520Pcf monomer2BIC X
6527Km23 homodimer1Z09 X
6529Ber e 1 monomer2LVF X
6530CC451YMZ X
6531S100 calcium-binding protein A131YUU 1YUT X
6532apo-S100A131YUS 1YUR X
6536hSH3-1 domain2GTJ X
6539hSH3-1 domain2GTO X
6540Werner syndrome protein2AXL X
6543HIV-1 frameshift inducing RNA1Z2J X
6549ligand binding domain of peroxisome proliferator-activated receptor gamma2QMV X
6551DNA excision repair protein ERCC-1, DNA repair endonuclease XPF (E.C.3.1.-.-)1Z00 2AQ0 X
6552redesigned apo-cytochrome b5621YZC X
6553Redesigned apo-cytochrome b5621YZA X
6554Alzheimer's disease amyloid1Z0Q X
6555protein YBL071w-A1YWS X
6556Programmed cell death protein 51YYB X
6557preS2 surface antigen1WZ4 X
6558Formin-binding protein 31YWJ X
6559Formin-binding protein 3/Formin complex1YWI X
6560redesigned apocytochrome B5621YYX 1YYJ X
6561plantaricin A1YTR X
6562D-loop from cloverleaf 1 of bovine enterovirus 1 RNA1Z30 X
6564OSCP N-terminal domain2BO5 X
6570F-actin binding domain of human Bcr-Abl/c-Abl1ZZP X
6573vacuolar protein sorting factor 4A1YXR X
6574MrR51YVC X
6580socs3 bound to a phosphotyrosine peptide2BBU X
6581Hematopoetic cell kinase SH3 domain - peptide complex2OI3 2OJ2 X
6589Chromo domain 1 of cpSRP431X32 X
6591Phe18Pff and Tyr20Pff AcAMP2 double mutant1MMC X
6594Leishmania major FYVE domain containing protein 11Z2Q X
6596vhl-11ZA8 X
6597Aryl hydrocarbon receptor nuclear translocator1X0O 2HV1 2A24 X
6598Prion-like protein doppel1Z65 X
6599Biotin Carboxyl Carrier Protein1Z6H X
6600Biotin Carboxyl Carrier Protein1Z7T X
6609dendritic cell-derived ubiquitin-like protein1TTN X
6612Ubiquitin-protein ligase E3 Mdm2 (E.C.6.3.2.-)1Z1M X
66132A proteinase1Z8R X
6615BsLonSSD monomer1X37 X
6620p22HBP monomer2GOV X
6624RA12BYE X
6625PHPT12AI6 2OZW 2OZX X
6627Kalata B11ZNU X
6629Outer membrane usher protein FimD1ZDV X
6631Splicing factor 3 subunit 11ZKH X
6633HIV-1 frameshift RNA signal1ZC5 X
6635RA22BYF X
6636PcFK1 monomer1X5V X
6637AcAMP2F18Nalb mutant1MMC X
6639AcAMP2F18W mutant1MMC X
6644assembly AlgH2MUI X
6645hv-DHFR12ITH X
6647AcAMP2F18Wb mutant1MMC X
6649Sporulation-specific N-acetylmuramoyl-L-alanine amidase (E.C.3.5.1.28)1X60 X
6652GAAA tetraloop/Recptor homodimer2ADT X
6654Jingzhaotoxin-VII1ZJQ 2AAP X
6655Zinc finger domains 1 and 2 of dsRBP-ZFa1ZU1 X
6656AcAMP2F18Pff/F20Pfff mutant1ZNT X
6681Gastric inhibitory polypeptide2OBU X
6682Zinc finger protein 5931ZR9 X
6690PSI AB complex with U1-70k proline-rich peptide2BN5 X
6692AppA2BUN X
6696PP5-TPR-peptide complex2BUG X
6699Calbindin D9k monomer2MAZ X
6714CSP12A1C X
6715Stannin1ZZA X
6716DNA primase (E.C.2.7.7.-)1Z8S X
6717Hypothetical UPF0213 protein BH00481ZG2 X
6718DHPs74e protein1ZV6 X
6720Alpha-conotoxin PIA1ZLC X
6721huntingtin-interacting protein HYPA/FBP111ZR7 2DYF X
6726CalC monomer1ZXF 2GKD 2L65 X
6727telomeric repeat-binding domain of Arabidopsis thaliana2AJE X
6728potassium channel KcsA2A9H X
6729DSP monomer2E2F X
6730Human Filamin A domain 172AAV X
6731BofC2BW2 X
6737Bacteriocin curvacin A2A2B X
6738Selenoprotein Sep152A4H X
6739Selenoprotein M2A2P X
6740Cysteine-rich secretory protein-22A05 X
6741Pulmonary surfactant-associated protein B2JOU 2DWF X
6742ataxin-3 josephin domain2AGA X
6743CcdA conformer a, b, and c homodimers2ADN 2ADL X
6746phnA-like protein rp44792AKK X
6748The Ki67FHA/hNIFK(226-269)3P complex2AFF X
6749mSin3B PAH1 and NRSF/REST2CZY X
6750MYB-KIX-MLL COMPLEX2AGH X
6751Asl16502AFE 2AFD X
6752PH-PDZ tandem of alpha-syntrophin1Z87 X
6753split PH1 domain of alpha-syntrophin2ADZ X
6755TA07432ABY X
6757membrane anchor domain of BVDV NS5A2AJJ 2AJM 2AJN 2AJO X
6759NEAT domain2H3K X
6760FRB domain2NPU X
6761UBL1 domain of TUG2AL3 X
6762Tor inhibition protein1Z4H X
6763middle domain of human eRF12HST X
6766pa01282AKL X
6769NE20662LKI X
6771Regulatory protein cro2A63 X
6774Bombinin H22AP7 X
6775Bombinin H42AP8 X
6776YFHJ2BZT X
6779Outer membrane usher protein fimD1ZDX X
6780hi15062OUT X
6781ada2 swirm domain polypeptide2AQF 2AQE X
6786MsrA2IEM X
679018:0 ACP from spinach2FVF 2FVA X
6794LM ICP2C34 X
6797OmlA2PXG X
6800Domain III of the E protein of Langat flavivirus2GG1 X
6801Human SUMO-2 monomer2AWT X
6803FecA N-terminal periplasmic signaling domain2D1U 2K1X X
6804Ztaq2B88 2K1W X
6805anti-Ztaq2B89 X
6806Ztaq:anti-Ztaq2B87 X
6809rabbitpox vCCI2FIN 2FFK X
6810C'-RcsC2AYX X
6811cadmium-transporting ATPase (E.C.3.6.3.3)2AJ0 X
6812ta09382FQH X
6814Class I RNA aptamer to GTP2AU4 X
6815Retrocyclin-22ATG X
6816RNA polymerase sigma factor RpoN2AHQ X
6817Alpha-conotoxin MII2AK0 X
6818Alpha-conotoxin MII-62AJW X
6820Caltractin2AMI X
6821Superoxide dismutase [Cu-Zn] (E.C.1.15.1.1)2AF2 X
6822hypothetical protein AF15032L7H X
6826AbhN dimer2FY9 X
6829Chitin binding domain2CZN X
6835Fowlicidin 12AMN X
6841Calmodulin-like protein 52B1U X
6843Caspase recruitment domain protein 42B1W X
6844U1 small nuclear ribonucleoprotein A2AYM X
6845Ribosome biogenesis protein Nop102AQC X
6846H/ACA ribonucleoprotein complex subunit 32AQA X
6849Grassostrea gigas defensin2B68 X
6850PRP40 FF12B7E X
6856uyp2AIZ X
6858pal bound to uyp2AIZ X
6860BC0220302GW6 X
6863Zinc finger domain of Mengovirus Leader polypeptide2BAI X
6865TRAP-TSR domain2BBX X
6867Envelope polyprotein GP1602ARI X
6868Protein ydhR precursor2ASY X
6869DNA polymerase III subunit tau2AYA X
6872kalata B82B38 X
6874CBP-SID domain in complex with SRC1-AD1 domain2C52 X
6876Chagasin2FO8 X
6882sushi domain of the interleukin-15 receptor2ERS X
6884YflL monomer2FHM X
6885Ig1 module2CKN X
6888Neocarzinostatin apo-protein with Flavone2G0L 2G0K X
6891MrIA2EW4 X
6892lung surfactant protein C2ESY X
6893Fibrinogen alpha chain2BAF X
6894Ral guanine nucleotide dissociation stimulator2B3A X
6895PROTEIN/RNA Complex2ERR XX
6896Alpha-conotoxin ImI2BC8 X
6897Alpha-conotoxin ImI2BC7 X
6898Genome linked protein VPg2BBP 2BBL X
6907V66W110 fragment of staphylococcal nuclease2F3V X
6908SNase110 fragment of Staphylococcal Nuclease2F3W X
6910SMP-12FE0 X
6912yeast thioredoxin 12I9H X
6914WILSON DISEASE ATPASE2ARF X
6915Dendroaspin monomer2LA1 X
6916Protein E72EWL 2F8B X
6919MAN1 655-775 domain2CH0 X
6920Midline-1 B-box Type 12FFW X
6921human cytochrome b5 with oxydized heme2I96 X
6922Vts1:RNA dimer2FE9 XX
6923FKBP382MF9 X
6924discrepin monomer2AXK X
6925Kid toxin2C06 X
6926TSP92FFT X
6927spinophlin PDZ domain2G5M X
6929NeT3 monomer2FGX X
6933Neurabin PDZ2FN5 X
6934Wzb monomer2FEK X
6938monomer region 51-160 of human KIN172V1N X
6943chemosensory protein 12JNT X
6945PSD-12FS1 X
6946g2 free2LKC X
6951Conotoxin pl14a2FQC X
6952Violacin A2FQA X
6953Major prion protein2FJ3 X
6954Hemagglutinin2DCI X
6955Hypothetical protein ydhA2F09 X
6956PROTEIN/RNA Complex2B6G XX
6957SCAN2FI2 X
6960CREB-binding protein2D82 X
696210:0 ACP from spinach2FVE X
6963Second Kunitz domain of human WFIKKN12DDJ 2DDI X
6964Rpa28292FVT X
6965CuA domain2FWL X
6969S2-HR2 trimer2FXP X
6971PDI-b'2DJK X
6972PDI-a'2DJJ X
6975Bcl2MidG4Pu23-G15T G16T2F8U X
6976Hypothetical UPF0346 protein yozE2FJ6 X
69795'-R(*GP*GP*UP*GP*AP*AP*GP*GP*CP*U)-3'/5'-R(*GP*CP*CP*GP*AP*AP*GP*CP*CP*(PR5))-3'2DD3 2DD2 X
6980BC0094742G2B X
6981BsaL2G0U X
6982TA08952G1E X
6986Phosphotyrosine binding domain of chicken tensin 12GJY X
6988HGB1-UBA monomer2DEN X
6989Ribosomal Protein S24E2G1D X
6991TFCD2CEH X
6993TFPP2CEF X
6995g2 complexed with GDP2LKD X
6996TFSP2532CEZ X
6997vSET complex with meK27 H3 Pept and cofactor product SAH2G46 X
6998TFSP2582CFJ X
6999KorA dimer2N5G X
7000Rv23022A7Y X
7001P-beta-Cat 19-442G57 X
7002Ede1 UBA-ubiquitin complex2G3Q X
7005Peptide YY2DF0 X
7006Peptide YY2DEZ X
7007AT5G39720.12G0Q X
7008Sodium/calcium exchanger 12FWU X
7009Sodium/calcium exchanger 12FWS X
7010Merozoite surface protein 12FLG X
701113-mer peptide from Thermonuclease (E.C.3.1.31.1)2FXZ X
701218-mer peptide from Thermonuclease (E.C.3.1.31.1)2FXY X
7014nsp12GDT X
7019nsp3a2GRI 2IDY X
7033GSPT1/eRF3a(PAM2-2) - PABC complex3THK X
7034hZHX1-ZNF2GHF X
7035NCK2 2nd SH32FRW X
7036NCK2 3rd SH32FRY X
7050MbGBP2DJ9 X
7051SlGBP2DJC X
7053cysteine catalytic half-domain of mouse E1 protein2V31 X
7054XCC17102GM2 X
7056DPDE2GMO X
7058MICAL 1 CH monomer2DK9 X
7061Talin-12G35 X
7063putative cytoplasmic protein2G7J X
7064Cycloviolacin O142GJ0 X
7065Gaegurin-42G9L X
7067Reticulon-42G31 X
7068Copper-transporting ATPase 1 (E.C.3.6.3.4)2GA7 X
7069Copper-transporting ATPase 1 (E.C.3.6.3.4)2G9O X
7070monomer2GO9 X
7074Zn-saturated Pf06102GMG X
7075conserved hypothetical protein pa24122GPF X
7078LCTI monomer2AIH X
7079RP28122GQB X
7080NTD-CTD complex2G9J X
7083SBD2DJM X
7085hypothetical protein yst64992GRG X
7087D4ED32H0P X
7089Metalloelastase monomer2MLS X
7092VrD22GL1 X
7093mMjCM in complex with a TSA2GTV X
7095Ubiquitin-like protein 32GOW X
7097brinker CG9653-PA/DNA Complex2GLO XX
7098RNA (35-MER)2GM0 X
7099wsv2302GJI X
7101Designed protein TOP72GJH X
7102Designed Protein AYE2GJF X
7103H98S ARD2HJI X
7106RGS18 monomer2JM5 2OWI X
7108TrxA monomer2GZY X
7109TrxA monomer2GZZ X
7111ubiquitin (microcrystal)2JZZ X
7112FBNYV M-Rep (2-95)2HWT X
7114E. coli maltose binding protein2H25 X
711692aa long hypothetical protein2GLW X
7117Hybrid atracotoxin2H1Z X
711932324 monomer2I3B X
7120Rho-GTPase-activating protein 72GYT X
7121UPF0301 protein HD 17942DO8 X
7122Methylated-DNA--protein-cysteine methyltransferase (E.C.2.1.1.63)2G7H X
7124B-box2 monomer2DQ5 X
7125HbCO A2M6Z X
71272F32H45 2H41 X
71281F3-2F32HA1 X
7129SH3 domain2GGR X
7137C-TERMINAL DOMAIN OF INSULIN-LIKE GROWTH FACTOR BINDING PROTEIN 22H7T X
7147Core-binding factor, ML1-ETO2H7B X
7150Talin/integrin/PIPKIg chimera complex2H7E 2H7D X
7151DLC2-SAM monomer2H80 X
71582nd RAN binding zinc finger from hNUP1532GQE X
7166CgNa toxin2H9X X
7167RICH protein2I3E X
7170sr482 monomer2HC5 X
7177Alpha-conotoxin Vc1A2H8S X
7178putative chaperone2GZP X
7180UPF0301 protein SO33462GZO X
7181Hypothetical protein PA43592H3J X
7182Hypothetical protein ycgL2H7A X
7184chemosensory protein CSP-sg42GVS X
7185Positive cofactor 2 glutamine/Q-rich-associated protein2GUT X
7186Spider toxin Magi 52GX1 X
7189Cj1258 monomer2GI4 X
7194TFIIIA zf46 & 5S rRNA complex2HGH XX
7201YqbF2HJQ X
7205ErbB4 TM dimer2LCX X
7209PilP2IVW X
7220ephrinB2 ectodomain monomer2I85 X
7223Interferon, alpha-inducible protein2HJ8 X
7224Phage-like element PBSX protein xkdW2HG7 X
7225UPF0291 protein ynzC2HEP X
7226Conserved protein MTH13682HGA X
7227Hypothetical protein yppE2HFI X
7228UPF0107 protein AF00552HI6 X
7229Small inducible cytokine B142HDL X
72305'-R(*GP*GP*CP*UP*AP*AP*GP*AP*C)-3', 5'-R(*GP*UP*CP*GP*AP*AP*GP*CP*C)-3'2H49 X
7232Pancreatic hormone2H3T X
7233Pancreatic hormone2H3S 2H4B X
7241Chromo domain 2 complexed with cpSRP54 peptide2HUG X
7243pMSP2IZ4 X
7251p53 tetramerization domain2J0Z X
7252p53 tetramerization domain2J11 2J10 X
7256Hydrogenase-1 operon protein hyaE2HFD X
7257RRM domain of SR rich factor 9G82HVZ X
7258Protein PB1-F2 (50-87)2HN8 X
7259DNA polymerase mu (E.C.2.7.7.7)2HTF X
7260YjcQ protein2HGC X
7261Hypothetical protein ykfF2HJJ X
72621-45IGFBP-62JM2 X
7263Meg-A122I1P X
7266NE16802HFQ X
7268TCAD1 monomer2V37 X
7269fivar doc2JNK X
7270x822O4E X
7271AF22412NNZ X
7272RGS102I59 X
7273Jingzhaotoxin-32I1T X
7274Hypothetical protein YdfO2HH8 X
7276Blo t 52MEY X
7282MHA62I9M X
7283MHB4A2I9N X
7284MHB8A2I9O X
7285double dockerin2J4N 2J4M X
7287BRD7 Bromodomain2I7K X
7288BNIP3 TM dimer2J5D X
7291Coxsackievirus and Adenovirus receptor2NPL X
7293recoverin bound to rhodopsin kinase fragment (RK25)2I94 X
7294bacillomycin Lc2IGZ X
7295Synthetic Cyclo Peptide (SCP)2IGZ X
7296H47A cyt c-5512I8F X
7297conserved hypotetical protein RPA13202IDA X
7298Znf-UBP domain of Ubp-M2I50 X
7299cfc2J5H X
7301SF2/ASF RRM22O3D X
7302SNX1-PX2I4K X
7305R21A Spc-SH3 monomer2JM8 X
7306R21A Spc-SH3 monomer2JM9 2JMA X
7313Pactolus I-domain2IUE X
7314L11 in complex with rRNA2E34 XX
7315L11 in complex with rRNA2E36 2E35 XX
7320PufX2NRG 2ITA X
7322apo-oncomodulin2NLN X
7323Colicin immunity protein IM22NO8 X
7324SelW2NPB X
7326En-1 monomer2NSV X
7327En-22NSW X
7330Alpha-neurotoxin TX122E0H X
7339MLP-like protein 282I9Y X
7341CYCLIC MRIA2J15 X
7342NUCLEOCAPSID PROTEIN2IWJ X
7349CONSERVED DOMAIN PROTEIN2C0S X
7350CONSERVED DOMAIN PROTEIN2BZB X
7351KIAA0252 PROTEIN2BZE X
7352GAG POLYPROTEIN2BL6 X
7354LAC REPRESSOR2BJC XX
7360DsbA oxidoreductase2IJY X
7361lin MCoTI2IT8 X
7362UPF01652NWT X
7364AG Endproducts2E5E X
7365WW domain2E45 X
7366Periplasmic protein2NOC X
7367L-222NS4 X
7371SiR52OA4 X
7376CzrA2M30 X
7381Alr1010 protein2P0P X
7382Nucleolar protein 32OSR X
7383Nucleolar protein 32OSQ X
7386homeobox2P81 X
7388pip172P5J X
7389pip92P5H X
7390CcV28C AdxL80C2JQR X
7395RWD/GI domain2YZ0 X
7396ETO2PP4 X
7401designed engrailed homeodomain variant UVF2P6J X
7402Latarcin-12PCO X
7414MMP12 HUMAN2JXY X
7415MMP12 HUMAN2JXY X
7419entity 12V6Z X
7420COMPLEMENT FACTOR H2JGW X
7421COMPLEMENT FACTOR H2JGX X
7423calmodulin2K61 X
7424calmodulin2K61 X
7425calmodulin2K61 X
7430ERp182K8V X
9500troponin complex1VDJ X
10001mastoparan-X2CZP X
10002F-spondin TSR41VEX X
10006FN3 domain of HYPOTHETICAL PROTEIN1WFU X
10008C-terminal FN3 domain of 1700129L13Rik protein1WFT X
10009SH3 domain of mouse Kalirin-9a protein1WFW X
10011the SWIRM domain of human LSD12COM X
10012troponin complex1VDI X
10013ring finger domain of KIAA1045 protein1WIL X
10014helix6 in SRP RNA2F87 X
10018RNA hairpin of eel LINE2FDT X
10019GSPT1/eRF3a(PAM2-1) - PABC complex2RQG X
10022K3 peptide of beta2-microglobulin2E8D X
10024PufX2DW3 X
10025MAP/microtubule affinity-regulating kinase 31UL7 X
10026MAP/microtubule affinity-regulating kinase 31V5S X
10027DnaA2E0G X
10028the second WW domain of mouse salvador homolog 1 protein (mWW45)2DWV X
10029membrane associated guanylate kinase inverted-21WFV X
10030T-plastin1WJO X
10031KIAA1617 protein1WJR X
10032KIAA1798 protein1WJS X
100331700030A21Rik protein1WJZ X
10034KIAA0970 protein1WK0 X
10035Hypothetical protein yk1067a121WK1 X
10036Protein CGI-381WLM X
10037KIAA1798 protein1WJQ X
10038Zinc finger protein 2951WJP X
10039FYVE, RhoGEF and PH domain containing 6; ethanol decreased 41WGQ X
10040Growth factor receptor-bound protein 71WGR X
10041MYST histone acetyltransferase 11WGS X
10042KIAA1068 protein1WGV X
10043Signal Recoginition Particle 541WGW X
10044ZF-HD homeobox family protein1WH5 X
10045ZF-HD homeobox family protein1WH7 X
10046Mitogen activated protein kinase kinase 51WI0 X
10047Homeobox leucine zipper protein Homez2ECC X
10048Tudor domain containing protein 31WJI X
10049Transcription elongation factor S-II protein 31WJT X
10050NEDD8 ultimate buster-11WJU X
10054UNR protein1WFQ X
10055Glia maturation factor gamma1WFS X
10056regulator of G-protein signaling 14; rap1/rap2 interacting protein1WFY X
10057nitrogen fixation cluster-like1WFZ X
10058Thioredoxin-like protein 21WIK X
10059Flotillin 21WIN X
10060C330018D20rik protein1WJK X
10061Cypher protein1WJL X
10063Intersectin 21UE9 X
10064MEMBRANE ASSOCIATED GUANYLATE KINASE INVERTED-2 (MAGI-2)1UEW X
10065putative nuclear protein homolog 5830484A20Rik1UFN X
10066KIAA1526 protein1UFX X
10067expressed protein1UHT X
10068Transgelin1UJO X
10069actin-binding LIM protein homologue1UJS X
10070Heterogeneous nuclear ribonucleoprotein H'1WEZ X
10071RNA-binding protein Raly1WF1 X
10072Heterogeneous nuclear ribonucleoproteins C1/C21WF2 X
10073putative elicitor-responsive gene1WFJ X
10074synaptotagmin XIII1WFM X
10075sidekick 21WFN X
10076sidekick 21WFO X
10077Eukaryotic translation initiation factor 4B1WI8 X
10079KIAA0561 protein1V9V X
10080putative 42-9-9 protein1V9W X
10081rhophilin, Rho GTPase binding protein 21VAE X
10082calcipressin 11WEY X
10083Regulating synaptic membrane exocytosis protein 21WFG X
10084nuclear distribution gene C homolog1WFI X
10085Heterogeneous nuclear ribonucleoprotein H1WG5 X
10086Rap guanine nucleotide exchange factor 51WGY X
1008759 kDa 2'-5'-oligoadenylate synthetase like protein1WH3 X
10088KIAA0147 protein1WHA X
10089Numb protein1WJ1 X
10090hypothetical protein F20O9.1201WJJ X
10091Tubulin-folding protein TBCE1WJN X
10092interleukin-1 receptor-associated kinase 41WH4 X
10093Homeobox protein Cux-21WH6 X
10094Homeobox protein Cux-21WH8 X
1009540S ribosomal protein S31WH9 X
10097SH3 domain-binding glutamic acid-rich-like protein 31J0F X
10098Diacylglycerol kinase, delta1R79 X
10099KIAA1568 Protein1UEM X
10100Membrane Associated Guanylate Kinase Inverted-2 (MAGI-2)1UEP X
101012610208M17Rik protein1UG7 X
10102KIAA1568 protein1UJT X
10103KIAA0147 protein1UJU X
10104polynucleotide kinase 3'-phosphatase1UJX X
10105hypothetical protein RAFL11-05-P191V31 X
10106hypothetical protein RAFL09-47-K031V32 X
10107microtubule-associated protein, RP/EB family, member 11V5K X
10108PDI-like Hypothetical Protein At1g604201V5N X
10109Glutamate Receptor Interacting Protein 1A-L Homolog1V5Q X
10110Growth-arrest-specific protein 21V5R X
10111Nucleolar transcription factor 11V63 X
10112DNA segment, Chr 7, Wayne State University 128, expressed1V86 X
10113SH2 and PH domain-containing adapter protein APS1V5M X
10114SET binding factor 11V5U X
10115Oxysterol binding protein-related protein 81V88 X
10118PH04712EXD X
10119KIAA0730 protein1IUR X
10120Lamin A1UFG X
10121immature colon carcinoma transcript 11J26 X
10122Intersectin 21J3T X
10123Hepatoma-derived growth factor, related protein 31N27 X
10124MEMBRANE ASSOCIATED GUANYLATE KINASE INVERTED-2 (MAGI-2)1UJV X
10125hypothetical protein RIKEN cDNA 2310016K041WHN X
10126Hypothetical KIAA1002 protein1WHR X
10127hypothetical PNPase1WHU X
10128second FNIII domain of DSCAML1 protein1VA9 X
10129sidekick 2 protein1WF5 X
10130NPL4 family protein1WF9 X
10131pleckstrin homology domain-containing, family A1V5P X
10132cytochrome c5512PAC X
10133cytochrome c5512PAC X
10136Intersectin 21UFF X
10137Lipocalin-type Prostaglandin D synthase2E4J X
10138Probable 16S rRNA-processing protein rimM2DOG X
10141AP-1 complex subunit gamma-22E9G X
10142Filamin-B2E9I X
10143Filamin-B2E9J X
10144Rho GTPase activating protein 5 variant2EE4 X
10145Rho GTPase activating protein 5 variant2EE5 X
10146Filamin-B2EE6 X
10147Sperm flagellar protein 12EE7 X
10148Protein odd-skipped-related 22EE8 X
10149Protein MICAL-22E9K X
10150SPCC24B10.08c protein2ELK X
10151Zinc finger protein 2682EN6 X
10152Zinc finger protein 2682EN7 X
10153Zinc finger protein 4842EOV X
10154Zinc finger protein 4732EOY X
10155Zinc finger protein 4842EP2 X
10156Zinc finger protein 4842YTS X
10157B-cell lymphoma 6 protein2EOS X
10158Zinc finger protein 4732EOU X
10159Filamin-B2EE9 X
10160Filamin-B2EEA X
10161Filamin-B2EEB X
10162Filamin-B2EEC X
10163Filamin-B2EED X
10164Uncharacterized protein C6orf1302EEE X
10165Protein phosphatase 1, regulatory (Inhibitor) subunit 3B2EEF X
10166Zinc finger protein 2682EM1 X
10167Zinc finger protein 28 homolog2EM2 X
10168Zinc finger protein 28 homolog2EM3 X
10169Zinc finger protein 2242EN8 X
10170Zinc finger protein 28 homolog2EN9 X
10171Zinc finger protein 2242ENA X
10172Zinc finger protein 2242ENC X
10173Zinc finger protein 3472ENE X
10174Zinc finger protein 3472ENF X
10175Zinc finger protein 28 homolog2ENH X
10176Zinc finger protein 28 homolog2YTM X
10177Zinc finger protein 4842YTP X
10178Zinc finger protein 4732YTT X
10179Zinc finger protein 28 homolog2EM4 X
10180Zinc finger protein 2242EM7 X
10181Zinc finger protein 2242EM9 X
10182Zinc finger protein 4732EME X
10183Zinc finger protein 4842EMF X
10184Zinc finger protein 4842EMG X
10185Zinc finger protein 2682YTF X
10186Zinc finger protein 95 homolog2YTG X
10187Zinc finger protein 2242YTH X
10188Zinc finger protein 3472YTI X
10189Zinc finger protein 95 homolog2EOM X
10191Zinc finger protein 2682EOP X
10192Zinc finger protein 2242EOQ X
10193Zinc finger ZZ-type-containing protein 32YUM X
10194RUN and TBC1 domain containing 32YUO X
10195Vinexin2YUP X
10196Zinc finger protein 95 homolog2EM5 X
10197Zinc finger protein 2242EM6 X
10198Zinc finger protein 2242EM8 X
10199Zinc finger protein 3472EMA X
10200Zinc finger protein 4732EMB X
10201Zinc finger protein 4732EMC X
10202Zinc finger protein 4842EMH X
10203Zinc finger protein 4842EMI X
10204Zinc finger protein 28 homolog2EMJ X
10205Zinc finger protein 28 homolog2EMK X
10206Zinc finger protein 28 homolog2EOH X
10207Zinc finger protein 3472EOW X
10208Zinc finger protein 4732EOX X
10209Zinc finger protein 4732EOZ X
10210Zinc finger protein 28 homolog2EP0 X
10211Tyrosine-protein kinase ITK/TSK (E.C.2.7.10.2)2YUQ X
10212SRC-like-adapter2CUD X
10213ATP-dependent RNA helicase DDX50 (E.C.3.6.1.-)2E29 X
10214Membrane-associated guanylate kinase2YSE X
10215Membrane-associated guanylate kinase2ZAJ X
10216Zinc finger protein 2682EOF X
10217Zinc finger protein 2682EOG X
10218Zinc finger protein 2682EOJ X
10219Zinc finger protein 2682EOK X
10220Zinc finger protein 95 homolog2EON X
10221Zinc finger protein 2242EOR X
10222Zinc finger protein 2682YTQ X
10223Zinc finger protein 3472YTR X
10224Zinc finger protein 2682EMV X
10225Zinc finger protein 2682EMW X
10226Zinc finger protein 2682EMX X
10227Zinc finger protein 2682EMY X
10228Zinc finger protein 95 homolog2EMZ X
10229Zinc finger protein 2682EN0 X
10230Zinc finger protein 2242EN1 X
10231B-cell lymphoma 6 protein2EN2 X
10232Zinc finger protein 95 homolog2EN3 X
10233Zinc finger protein 3472EN4 X
10234Zinc finger protein 3472YU8 X
10235amyloid beta (A4) precursor protein-bindin, family B, member 21WGU X
10236peptide from Amyloid beta A4 protein, Amyloid beta A4 precursor protein-binding family B member 22ROZ X
10237Amyloid beta A4 precursor protein-binding family B member 2 and Amyloid beta A4 protein2YSZ X
10238Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 22YT0 X
10239Amyloid beta A4 protein and Amyloid beta A4 precursor protein-binding family B member 22YT1 X
10240cortactin isoform a1X69 X
10241Rho guanine exchange factor (GEF) 161X6B X
10242Interleukin-161X6D X
10243Zinc finger protein 241X6E X
10244Zinc finger protein 4621X6F X
10245Megakaryocyte-associated tyrosine-protein kinase1X6G X
10246Transcriptional repressor CTCF1X6H X
10247NEDD9 interacting protein with calponin homology and LIM domains2CO8 X
10248HMG-BOX transcription factor BBX1WZ6 X
10249Pleckstrin1X05 X
10250Signal-transducing adaptor protein 11X1F X
10251Pleckstrin 21X1G X
10252thymus high mobility group box protein TOX2CO9 X
10253Protein kinase C, D2 type2COA X
10254FYVE, RhoGEF and PH domain containing protein 32COC X
10255ARAP2 protein2COD X
10256Hypothetical protein KIAA19142COF X
10257Zinc finger BED domain-containing protein 22DJR X
10258Ephrin type-B receptor 12DJS X
10259human unnamed protein product2DJT X
10260Receptor-type tyrosine-protein phosphatase F2DJU X
10261Methionyl-tRNA synthetase2DJV X
10262Collagen alpha-1(XX) chain2DKM X
10263Receptor-type tyrosine-protein phosphatase F2DN7 X
10264signal transducing adaptor molecule 21X5B X
10265Protein tyrosine phosphatase, receptor type, F2EDX X
10266Receptor-type tyrosine-protein phosphatase F2EDY X
10267PDZ domain-containing protein 12EDZ X
10268Protocadherin-92EE0 X
10269Chromodomain helicase-DNA-binding protein 42EE1 X
10270Contactin-12EE2 X
10271Collagen alpha-1(XX) chain2EE3 X
10272SH3 and PX domain-containing protein 2A2EKH X
10273Developmentally-regulated GTP-binding protein 12EKI X
10274Collagen alpha-1(XX) chain2EKJ X
10275PAAD DAPIN, UNP residues 8-882YU0 X
10276Tudor domain-containing protein 32D9T X
10277Chromobox protein homolog 2 (isoform 2)2D9U X
10278Pleckstrin homology domain-containing protein family B member 12D9V X
10279Docking protein 22D9W X
10280Oxysterol binding protein-related protein 112D9X X
10281Paired box protein Pax62CUE X
10282FLJ21616 protein2CUF X
10283Alpha-fetoprotein enhancer binding protein2DA1 X
10284Alpha-fetoprotein enhancer binding protein2DA2 X
10285Alpha-fetoprotein enhancer binding protein2DA3 X
10286Hypothetical protein DKFZp686K211562DA4 X
10287Zinc fingers and homeoboxes protein 32DA5 X
10288Hepatocyte nuclear factor 1-beta2DA6 X
10289Zinc finger homeobox protein 1b2DA7 X
10290Homeobox protein DLX-52DJN X
10291Homeobox protein TGIF2LX2DMN X
10292Zinc fingers and homeoboxes protein 22DMP X
10293LIM/homeobox protein Lhx92DMQ X
10294Homeobox protein OTX22DMS X
10295Homeobox protein BarH-like 12DMT X
10296Homeobox protein goosecoid2DMU X
10297Transcription factor 82E19 X
10298Homeobox and leucine zipper protein Homez2YS9 X
10299Tripartite motif protein 9, isoform 22DB8 X
10300Proto-oncogene tyrosine-protein kinase MER precursor2DBJ X
10301Crk-like protein2DBK X
10302SH3-containing GRB2-like protein 22DBM X
10303Zinc finger protein 28 homolog2EML X
10304Zinc finger protein 95 homolog2EMM X
10305Zinc finger protein 3472EMP X
10306B-cell lymphoma 6 protein2YRM X
10307Zinc finger protein 4732YTD X
10308Zinc finger protein 4732YTE X
10309Zinc finger protein 4842YTJ X
10310Zinc finger protein 3472YTK X
10311Pleckstrin homology domain-containing protein family A member 62D9Y X
10312Solution structure of the PH domain of Protein kinase C, nu type from human2D9Z X
10313130-kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein2DA0 X
10314Pleckstrin homology domain-containing family B member 22DHI X
10315Rho GTPase activating protein 212DHJ X
10316TBC1 domain family member 22DHK X
10317Pleckstrin homology domain-containing family A member 52DKP X
10318KIAA1075 protein2DKQ X
10319KIAA0640 protein2DN6 X
10320Filamin-B2DI9 X
10321Filamin-B2DIB X
10322Filamin-B2DIC X
10323Filamin-B2DJ4 X
10324Filamin-B2DLG X
10325Filamin-B2DMB X
10326Filamin-B2DMC X
10327Tripartite motif protein 452DS4 X
10328Filamin-C2D7M X
10329Filamin-C2D7N X
10330Filamin-C2D7O X
10331Filamin-C2D7P X
10332Filamin-C2D7Q X
10333BK158 12DI7 X
10334Filamin-B2DI8 X
10335Filamin-B2DIA X
10336Thioredoxin-like protein 11WWY X
10337Suppressor of T-cell receptor signaling 12E5K X
11002antimicrobial peptide RP-12RLG X
11003antimicrobial peptide RP-12RLH X
11004Ebola fusion peptide2RLJ X
11006Extracellular domain of mouse NOTCH 1EGF122RQZ XX
11007FBP28WW2-PTPPPLPP2RLY X
11008FBP28WW2-PPPLIPPPP2RM0 X
11009Dm LSm16 monomer2RM4 X
11010Rac1/HR1b complex2RMK X
11011CopA2RML X
11012p63BDB2RMN X
11014TAR-TAR*GA aptamer kissing complex2RN1 X
11016Lysarg2RN5 X
11017TnpE protein2RN7 X
11018Itk SH32RN8 X
11019Cox17 monomer2RN9 X
11020Cu(I)Cox172RNB X
11022big defensin monomer2RNG X
11024VRAR DNA binding domain2RNJ X
11026SHA (single chain polypeptide)2RMO X
11029Siz1 1-1112RNN X
11030Siz1 1-1052RNO X
11032the knotted tudor domain2RO0 X
11033the presumed chromodomain2RNZ X
11034SpoVTN dimer2RO5 X
11038The DNA binding domain of RTBP12ROH X
11040Eps8L1SH32ROL X
11041Human ATP7B2ROP X
11042RelE2KHE X
11043SHH (single chain polypeptide)2ROT X
11044Magi42ROO X
110455'-D(*DTP*DAP*DCP*DG)-3' 10 structures2RPD XX
110465'-D(*DTP*DAP*DCP*DG)-3' 10 structures2RPE XX
110485'-D(*DTP*DAP*DCP*DG)-3' 10 structures2RPH XX
11049BARpeptide2RND X
11050BARpeptide2RMY X
11054insect chemokine2RPS X
11060PH04702RPB X
11061APOBEC22RPZ X
11062lipocalin-type prostaglandin D synthase2RQ0 X
11064HET-s(218-289)2MUS X
110654.1R FERM alpha-lobe domain2RQ1 X
11072big-N2RQ2 X
11073JHBP-JH III complex2RQF X
11076MESD core region2RQK X
11077HPF2RQL X
11078Myeloid differentiation primary response protein MyD882Z5V X
11080CsPin2RQS X
11081DDEF1 SH32RQT X
11082DDEF1 SH3:APC SAMP1 complex2RQU X
11083Acidic leucine-rich nuclear phosphoprotein 32 family member B2ELL X
11084Calponin-21WYN X
11085NEDD9 interacting protein with calponin homology and LIM domains1WYL X
11086Microtubule-associated protein RP/EB family member 31WYO X
11087Unc-112-related protein 22YS3 X
11088Dynamin-22YS1 X
11089Pleckstrin homology domain-containing family A member 62YRY X
11090Hydrocephalus-inducing protein homolog2YS4 X
11091HYDIN protein2E6J X
11092Mortality factor 4-like protein 12EFI X
11093Tyrosine-protein kinase ITK/TSK (E.C.2.7.10.2)2E6I X
11094Fibroblast growth factor receptor substrate 3, ALK tyrosine kinase receptor2YS5 X
11095Fibroblast growth factor receptor substrate 3 and ALK tyrosine kinase receptor2YT2 X
11096Netrin receptor DCC2ED7 X
11097Netrin receptor DCC2EDD X
11098Netrin receptor DCC2EDE X
11099Netrin receptor DCC2EDB X
11100Protein disulfide-isomerase A62DML X
11101Protein disulfide-isomerase A42DJ1 X
11102Protein disulfide-isomerase A32DMM X
11103Netrin receptor DCC2ED8 X
11104Protein disulfide-isomerase A42DJ2 X
11105Thioredoxin-related transmembrane protein 22DJ0 X
11106midline 2 isoform 22DMK X
11107Thioredoxin domain-containing protein 52DIZ X
11108Thioredoxin-like protein 22DIY X
11109Protein disulfide-isomerase A42DJ3 X
11110Tenascin-X2CUM X
11111Neogenin1X5K X
11112Neogenin1X5I X
11113Thioredoxin domain containing protein 11X5E X
11114Protein disulfide-isomerase1X5C X
11115Complex structure of the zf-CW domain and the H3K4me3 peptide2RR4 X
11116Protein disulfide-isomerase A61X5D X
11117Ephrin type-A receptor 11X5A X
11118Neogenin1X5J X
11119Neogenin1X5F X
11120Neogenin1X5H X
11121Neogenin1X5G X
11122Smooth muscle cell associated protein-1, isoform 22DBA X
11123SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily C member 12YUS X
11124Calponin 11WYP X
11125Fibronectin type-III domain containing protein 3a1X4X X
11126Spectrin beta chain, brain 21WYQ X
11127biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding protein1X4Z X
11128biregional cell adhesion molecule-related/down-regulated oncogenes (Cdon)binding protein1X4Y X
11129Rho guanine nucleotide exchange factor 61WYR X
11130Zinc finger protein 5122CTD X
11131Zinc finger, FYVE domain containing 27 isoform b1X4U X
11132novel protein2CTO X
11133L-plastin2D85 X
11134WD repeat and HMG-box DNA binding protein 12D7L X
11135Vigilin2CTJ X
11136Vigilin2CTK X
11137Vigilin2CTM X
11138Vigilin2CTL X
11139Vigilin2CTE X
11140final0012CTF X
11141Vav-3 protein2D86 X
11142Smoothelin splice isoform L22D87 X
11143Protein MICAL-32D88 X
11144Williams-Beuren syndrome chromosome region 18 protein2YUA X
11145EHBP1 protein2D89 X
11146Eukaryotic translation initiation factor 52E9H X
11147High mobility group protein B12YRQ X
11148Nuclear factor of activated T-cells, cytoplasmic 42YRP X
11150Ectonucleotide pyrophosphatase/phosphodiesterase family member 12YS0 X
11151Protein kinase C delta type2YUU X
11152Integrin beta-42YRZ X
11153130 kDa phosphatidylinositol 4,5-biphosphate-dependent ARF1 GTPase-activating protein2ED1 X
11154Sorbin and SH3 domain-containing protein 12ECZ X
11155Abl interactor 22ED0 X
11156Nostrin2YUN X
11157Cytoplasmic tyrosine-protein kinase BMX2YS2 X
11158Transcription factor SOX-172YUL X
11159Retinoblastoma-binding protein 62YUR X
11160Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog2YUK X
11161Tripartite motif-containing protein 302ECW X
11162RING finger protein 1262ECT X
11163Tripartite motif-containing protein 52ECV X
11164TNF receptor-associated factor 32ECY X
11165Zinc finger protein 2682EOI X
11166Zinc finger protein 2682EOL X
11167Zinc finger protein 3472EOE X
11168Zinc finger protein 3472YTN X
11169Zinc finger protein 4842EP1 X
11170Zinc finger protein 4842EP3 X
11171Zinc finger protein 4842YTO X
11173Ubiquitin carboxyl-terminal hydrolase 52DAG X
11175F-actin binding protein2RR8 X
11176AML222RRC X
11178Olygophrenin-1 like protein1UGV X
11179SH3-domain kinase binding protein 11WI7 X
11180RIM binding protein 21WIE X
11181KIAA1496 protein1WJ3 X
11182Regulating synaptic membrane exocytosis protein 12CSS X
11183RIM binding protein 22CSP X
11184RIM binding protein 22CSQ X
11185RIM binding protein 22CSI X
11186InaD-like protein2D92 X
11187InaD-like protein2DAZ X
11188InaD-like protein2DB5 X
11189InaD-like protein2DLU X
11190InaD-like protein2DMZ X
11191InaD-like protein2DM8 X
11192Myosin binding protein C, fast-type2DLT X
11193SH3 and PX domain-containing protein 2A2EGA X
11194SH3 and PX domain-containing protein 2A2EGC X
11195Rho guanine nucleotide exchange factor 112DLS X
11196Uncharacterized protein KIAA16662EGE X
11197InaD-like protein2EHR X
11198synapse-associated protein 1021UM7 X
11199Enigma homologue protein1WF7 X
11200MAGUK p55 subfamily member 51VA8 X
11201KIAA1095 protein1WH1 X
11202Neurabin-I1WF8 X
11203Calcyclin-binding protein1X5M X
11204Harmonin1X5N X
11205Zinc finger protein 4352COT X
11206Glutamate receptor interacting protein 21X5R X
11207LAP4 protein1X5Q X
11208Ephrin type-A receptor 81X5L X
11209SH3 domain GRB2-like protein B11X43 X
11210amyloid beta (A4) precursor protein-binding, family A, member 1 (X11)1X45 X
11211Myosin-binding protein C, slow-type1X44 X
11212Myosin-binding protein C, slow-type2DAV X
11213SH3YL1 protein2D8H X
11214SH3 domain of Fyn-related kinase2D8J X
11215T-cell lymphoma invasion and metastasis 1 variant2D8I X
11216PDZ domain containing protein 12D90 X
11217SH3 domain of Stac protein2DL4 X
11218CIDE-N domain of human cell death activator CIDE-A2EEL X
11219Sorbin and SH3 domain-containing protein 12DL3 X
11220second SH3 domain of human KIAA0769 protein2DL7 X
11221Ig-like domain of Obscurin-like protein 12E6Q X
11222first SH3 domain of human KIAA0769 protein2DL5 X
11223Leucine-rich repeat-containing protein 42DL9 X
11224Phospholipase C, gamma 22EQI X
11225SLIT-ROBO Rho GTPase-activating protein 22DL8 X
11226MAGUK p55 subfamily member 22E7K X
11227Ephrin type-B receptor 42E7H X
11228Rho guanine nucleotide exchange factor 92YSQ X
11229Obscurin-like protein 12E6P X
11230Obscurin2E7B X
11231KIAA1837 protein2YRL X
11232Protein KIAA03192E7M X
11233KIAA1783 protein2DLP X
11234Tripartite motif-containing protein 312YSL X
11235Myosin-binding protein C, fast-type2E7C X
11236Myosin light chain kinase, smooth muscle2YR3 X
11237Myeloid/lymphoid or mixed-lineage leukemia protein 3 homolog2YSM X
11238Zinc finger protein 4732YRH X
11239Zinc finger protein 4732YRJ X
11240Lipoamide acyltransferase component of branched-chain alpha-keto acid dehydrogenase complex, mitochondrial2COO X
11242Vinexin2DLM X
11244Nuclear receptor corepressor 12EQR X
11245ubiquitin-like 51UH6 X
11246Afadin 61WLN X
11247Ubiquitin ligase protein RNF82CSW X
11248LIM domain kinase 22YUB X
11250nuclear valocine containing protein like 2 (NVL2)2RRE X
11251Zinc finger FYVE domain-containing protein 212RRF X
11252HRDC domain from Bloom syndrome protein2RRD X
112531700011N24Rik protein1V5O X
11254cytoskeleton-associated protein 11V6E X
11255Nuclear receptor coactivator 51V95 X
11256Ubiquitin carboxyl-terminal hydrolase 141WGG X
11257ubiquitin-like 31WGH X
11258RIKEN cDNA 2900073H19 protein1WGK X
11259Toll-interacting protein1WGL X
11260ubiquitin associated protein1WGN X
11261Ubiquilin 31WX7 X
11262RIKEN cDNA 4931431F191WX8 X
11263HLA-B associated transcript-3 isoform b1WX9 X
11264Afadin1WXA X
11265A-Raf proto-oncogene serine/threonine-protein kinase1WXM X
11266Np95-like ring finger protein, isoform a1WY8 X
11267Ubiquitin-like protein SMT3B1WZ0 X
11268Ubiquitin-like protein SB1321X1M X
11269KIAA0733 protein2DAE X
11270FLJ35834 protein2DAF X
11271Ubiquilin-32DAH X
11272KIAA0977 protein2DAJ X
11273Protein KIAA07942DAL X
11274ETEA protein2DAM X
11275poly (ADP-ribose) polymerase family, member 10 variant2DHX X
11276CUE domain-containing protein 12DHY X
11277Rap guanine nucleotide exchange factor (GEF)-like 12DHZ X
11278Activating signal cointegrator 1 complex subunit 22DI0 X
11279Ubiquitin-like protein 4A2DZI X
11280Synaptic glycoprotein SC22DZJ X
11281UBX domain-containing protein 22DZK X
11282Protein FAM100B2DZL X
11283FAS-associated factor 12DZM X
11284Hypothetical protein FLJ215221WXT X
11285peroxisomal biogenesis factor 131WXU X
11286Synapse associated protein 11X3A X
11287Zinc finger protein 2921X3C X
11288Fibronectin type-III domain containing protein 3a1X3D X
11289Leupaxin1X3H X
11290Fibronectin type-III domain containing protein 3a1X5X X
11291myosin binding protein C, fast-type1X5Y X
11292Receptor-type tyrosine-protein phosphatase delta1X5Z X
11293Cysteine-rich protein 22CU8 X
11294RWD domain containing protein 22DAW X
11295Protein C21orf62DAX X
11296RING finger protein 252DAY X
11297Lamin-B receptor2DIG X
11298TFIIH basal transcription factor complex p62 subunit2DII X
11299Proline-serine-threonine phosphatase-interacting protein 12DIL X
11300Cell division cycle 5-like protein2DIM X
11301Cell division cycle 5-like protein2DIN X
11302Zinc finger protein 64, isoforms 1 and 22DMD X
11303RING finger protein 252DMF X
11304Neural cell adhesion molecule 22DOC X
11305Actin Binding LIM Protein 21V6G X
11306Deltex protein 21V87 X
11307KIAA0161 protein1WIM X
11308Protein arginine N-methyltransferase 31WIR X
11309Cell growth regulating nucleolar protein LYAR1WJV X
11310phosphoacetylglucosamine mutase1WJW X
11311Transforming growth factor-beta induced protein IG-H31X3B X
11312Zinc finger protein 64, isoforms 11X5W X
11313Zinc finger protein 183-like 12CSY X
11314Synaptotagmin-like protein 42CSZ X
11315Non-SMC element 1 homolog2CT0 X
11316Transcriptional repressor CTCF2CT1 X
11317Tripartite motif protein 322CT2 X
11318Cdc42-interacting protein 42CT4 X
11319Zinc finger BED domain containing protein 12CT5 X
11320sh3 domain-binding glutamic acid-rich-like protein 22CT6 X
11321RING finger protein 312CT7 X
11322KIAA1915 protein2CU7 X
11323Zinc finger MYND domain containing protein 102D8Q X
11324THAP domain-containing protein 22D8R X
11325cellular modulator of immune recognition2D8S X
11326RING finger protein 1462D8T X
11327Ubiquitin ligase TRIM632D8U X
11328Zinc finger FYVE domain-containing protein 192D8V X
11329Possible global transcription activator SNF2L22DAT X
11330Paf1/RNA polymerase II complex component2DB9 X
11331Midline-22DJA X
11332Polycomb group RING finger protein 62DJB X
11333RING finger and CHY zinc finger domain-containing protein 12DKT X
11334PHD finger protein 32DME X
11335Cell growth regulator with RING finger domain protein 12EA5 X
11336RING finger protein 42EA6 X
11337RWD domain-containing protein 32EBK X
11338RWD domain-containing protein 12EBM X
11339Baculoviral IAP repeat-containing protein 42ECG X
11340TNF receptor-associated factor 62ECI X
11341Tripartite motif-containing protein 392ECJ X
11342RING-box protein 22ECL X
11343RING finger and CHY zinc finger domain-containing protein 12ECM X
11344RING finger protein 1412ECN X
11345Transcriptional adapter 22ELJ X
11346Tumor necrosis factor receptor superfamily member 12A2RPJ X
11347PHD finger protein 21A2YQL X
11348KIAA1787 protein2E63 X
11349Skeletal muscle LIM-protein 31X4K X
11350Skeletal muscle LIM-protein 31X4L X
11351Protein neuralized2YUE X
11352inhibitor of growth family, member 1-like1WES X
11353Inhibitor of growth protein 31X4I X
11354inhibitor of growth family, member 4 ING1-like protein1WEN X
11355Pre-mRNA-splicing factor 182DK4 X
11356Rho guanine nucleotide exchange factor 61UJY X
11357Transcription elongation regulator 12DK7 X
11358Zinc finger CW-type PWWP domain protein 12E61 X
11359Zinc finger CW-type PWWP domain protein 12E61 X
11360Zinc finger CW-type PWWP domain protein 12E61 X
11361Zinc finger CW-type PWWP domain protein 12E61 X
11362Zinc finger CW-type PWWP domain protein 12E61 X
11363Zinc finger HIT domain containing protein 21X4S X
11364Splicing factor 3 subunit 12DT6 X
11365PROTEIN2DT7 X
11366spliceosomal protein complex p14-SF3b1552FHO X
11367spliceosomal protein SF3b1552FHO X
11368Zinc finger protein 95 homolog2YSO X
11369Zinc finger protein 2242YSP X
11370Tia1 protein2RNE X
11371Tia1 protein2RNE X
11372Tia1 protein2RNE X
11373Tia1 protein2RNE X
11374Tia1 protein2RNE XX
11375Tia1 protein2RNE XX
11376Tia1 protein2RNE X
11377POZ-, AT hook-, and zinc finger-containing protein 12EPP X
11378POZ-, AT hook-, and zinc finger-containing protein 12EPQ X
11379POZ-, AT hook-, and zinc finger-containing protein 12EPR X
11380POZ-, AT hook-, and zinc finger-containing protein 12EPS X
11417DnaJ homolog subfamily B member 82DMX X
11419vasoactive intestinal peptide2RRH X
11420Vasoactive intestinal peptide2RRI X
11422CTP pyrophosphohydrolase2RRK X
11423Flagellar hook-length control protein2RRL X
11424tight junction protein ZO-12RRM X
11426Probable SecDF protein-export membrane protein2RRN X
11437Propylene-DNA2RRQ X
11438Protein2RRR X
11439LC4 transmembrane segment of CCR52RRS X
11440Mg(2+) -bound form of calmodulin C-terminal domain2RRT X
11443Sequestosome-12RRU X
11450RNA-binding protein Musashi homolog 12RS2 XX
11451peptidyl-prolyl cis-trans isomerase2RS4 X
11452stomagen2LIY X
11456Solution structure of the N-terminal dsRBD from RNA helicase A2RS6 X
11457Solution structure of the second dsRBD2RS7 X
11458N-terminal RNA recognition motif of NonO2RS8 X
11463Bromodomain of human BRPF1 in complex with histone H4K5ac peptide2RS9 X
11468THE BOMBYX MORI LYSOZYME2RSC X
11469the plant homeodomain (PHD) of the E3 SUMO ligase Siz1 from rice2RSD X
11471FKBP12-mTOR FRB domain-rapamycin complex structure2RSE X
11472WWE domain in RNF146 with ATP2RSF X
11473CERT PH domain2RSG X
11474protein2RUT X
11475protein2RUU X
11476protein2RUW X
11477protein2RUX X
11478protein2RUY X
11479protein2RUZ X
11480protein2RV0 X
11481protein2RV1 X
11482protein2RV2 X
11483protein2RV3 X
11484protein2RV4 X
11485protein2RV5 X
11486protein2RUV X
11487protein2RV7 X
11488protein2RV6 X
11489RNA aptamer against prion protein2RU7 XX
11491the mitochondrial disease-related protein C12orf652RSM X
11496the chromodomain of Chp1 in complex with H3K9me3 peptide2RSN X
11497the chromodomain of Swi62RSO X
11502Cu(I) bound D1CCS2RSQ X
11504SPOC domain of the human transcriptional corepressor SHARP in complex with SMRT2RT5 X
11505Alternative structure of Ubiquitin2RSU X
11506human full-length vaccinia related kinase 1 (VRK1)2RSV X
11507an inhibitor protein of DL-endopeptidases2RSX X
11508Csk SH2:Cbp phosphopeptide complex2RSY X
11523the second RRM domain of Nrd12RT3 X
11524AF.2A12RT4 X
11525PriC N-temrinal domain2RT6 X
11528METALLO-BASE-PAIRED DNA2RT8 X
11529a regulatory domain of meiosis inhibitor2RT9 X
11530chitin binding domain12RTS X
11531the chitin-binding domain of Chi18aC from Streptomyces coelicolor2RTT X
11532oxidized human HMGB1 A box2RTU X
11534the GGQ domain of YaeJ protein2RTX X
11535Navitoxin2RTY X
11536MarkTX-72RTZ X
11537actinomycin2RU0 X
11538TPI-LPS2MDB X
11539PROTEIN2RTV X
11540esf32RU1 X
11541Protein-RNA Complex2RU3 XX
11543[G5,T7,S9]-oxytocin2RU2 X
11544ARMADILLO REPEAT PROTEIN SELF-ASSEMBLED COMPLEX (YIIM2-MAII)2RU4 X
11546sin12RVK X
11547the pure alternative state of ubiquitin2RU6 X
11548MA2RU5 X
11549DnaT2RU8 X
11551anoplin2MJQ X
11552anoplin2MJR X
11553anoplin2MJS X
11554anoplin2MJT X
11555the YAM domain of E. coli Transporter YajR2RU9 X
11559wild type hPin1 PPIase domain2RUC X
11560C113D mutant human Pin1 PPIase domain2RUD X
11561a' domain of Protein Disulfide Isomerase (oxidized form)2RUE X
11562a' domain of Protein Disulfide Isomerase (reduced form)2RUF X
11563The first RNA recognition motif domain2RUG X
11569MIP-MDM22RUH X
11570SrtA AX bocLPAT2RUI X
11578complex between p53 transactivation domain 2 and TFIIH p62 PH domain2RUK X
11580Fusion peptide in DPC micelles2RUM X
11581Pre transmembrane domain in DPC micelles2RUN X
11582Internal fusion peptide in DPC micelles2RUO X
11583P2XHD monomer2RUP X
11587Human Pin PPIase C113A mutant2RUQ X
11588Human Pin1 PPIase C113S mutant2RUR X
11590PhoP DNA-Binding Domain2RV8 X
11591chitosan-binding module 12RV9 X
11592chitosan-binding module 22RVA X
11594The Acidic String of the Nucleotide Excision Repair Factor XPC2RVB X
11595Zalpha domain2RVC X
11597Monosiga brevicollis CRK/CRKL homolog (crka1) SH2 domain2RVF X
11599eIF12RVH X
11601hESRP1-RRM32RVJ X
11607Reverse transcriptase recognition site of transcript of a LINE from Denio Renio, LS-12RVO X
11608DNA CONTAINING METALLO-BASE-PAIR2RVP X
11609histone H2A-H2B heterodimer2RVQ X
12032NS1 effector domain6NU0 X
15000F5-Phe-cVHP2JM0 X
15001ADD domain2LD1 X
15007msp-1 c-terminal domain2NPR X
15013SPCp41 monomer2JMC X
15016WW4 - peptide complex2JMF X
15020exWIP-EVH12IFS X
15021homodimer2I7U X
15023CarA(Nter)2JML X
15025sMTM72NVJ X
15028Trx-ArsC complex2IPA X
15032FimF2JMR X
15037human beta-microseminoprotein2IZ3 X
15038pfFKBP35FKBD2OFN X
15039Chain 12JMK X
1504013-mer analogue of Prophenin-1 containing WWW2I1E X
1504113-mer analogue of Prophenin-1 containing WWW2I1F X
15042Tritrp52I1G X
15043none2I1H X
15044none2I1I X
15045BBP+EF in DHPC micelles2JMM X
15046Subunit F of the A1AO ATP synthase from Methanosarcina mazei Go12OV6 X
15051Prophenin12I1D X
15055N-term of dnaA2JMP X
15058En-6 monomer2JMS X
15059MLP2O10 2O13 X
15063ThTPase mouse2JMU X
15068UA1592I2J X
15069TCP32I2H X
15072oscp-nt alpha-nt2JMX X
15074IBR domain of Parkin2JMO X
15079ER382A2JN0 X
15080Yeast U2 stem I2O32 2O33 X
15081Human U2 Stem I2O32 2O33 X
15083SIGMA-54 RPON DOMAIN-DNA COMPLEX2O8K 2O9L XX
15084CDA-BABP complex2JN3 X
15085RP4601 assembly2JN4 X
15086hypothetical protein Cgl27622JN6 X
15088ER4112JN7 X
15089StR652JN8 X
15090str109 homodimer2MA8 X
15095Alpha-Syn12 bound with Synphilin-12JN5 X
15098CHROMODOMAIN-HELICASE-DNA-BINDING PROTEIN 82CKA X
15099CM15 in DPC micelles2JMY X
15103NW domain 62NX6 X
15104NW domain 82NX7 X
15105clip monomer2IKD X
15106clip monomer2IKE X
15107GPM122E4E X
15108p12IMU X
15109CPH domain2JNG X
15110Lymphotactin2HDM X
15111Cbl-b2JNH X
15112holo-c2sod2K4W X
15113NC:muPsi complex2IHX XX
15115arenicin-22JNI X
15120MMP3 complexed with NNGH2JNP X
15124Complex of VIR165 and FP1-232JNR X
15125monomer2JNS X
15126CmtB2OQ3 X
15128RGS domain from human RGS14 protein2JNU X
15133Uncharacterized BCR2JNY X
15134phl p 32JNZ X
15137CAC monomer2JO0 X
15139NirD2JO6 X
15140mytilin2EEM X
15142DL2A homodimer2E8J X
15145neurotensin2OYW 2OYV X
15152HypC2OT2 X
15153WW3-PPPPYP2JO9 X
15154protein-peptide complex2JOA X
15157Duck HBV epsilon apical tetraloop2OJ7 2OJ8 X
15158Bd372JO7 X
15159phosphoit302JOC X
15160polymerase eta UBZ domain2I5O X
15166pac1r/pacap2JOD X
15167YehR2JOE X
15169monomer2JOF X
15174[L-Phe44]iota-RXIA (r11a)2P4L X
15189CD5d12JOP X
15190HP04952JOQ X
15192alphaC-Domain Fragment2JOR X
15195M conotoxin Mr3.42EFZ X
15197CaBP12K7B 2K7C X
15203CPE0013 monomer2JOV X
15206Needle Monomer2JOW X
15208Churchill2JOX X
1521050s ribosomal protein l14e2JOY X
15211protein yxeF2JOZ X
15215XCL1/Lymphotactin2JP1 X
15218ATWLPPR heptapeptide2JP5 X
15226Kaliotoxin2UVS X
15229Translation initiation factor2NXU X
15232v8pf2PQE X
15240ERCC1 central2JPD X
15242a single polypeptide chain2JPE X
15245villin G34L monomer2PPZ X
15246PA40902JPI X
15247POTRA2V9H X
15252UvsW.12JPN X
15256ApolPBP2JPO X
15257RsmE dimer with two RNA stem loops2JPP XX
15258VP21292JPQ X
15259lcnGa2JPJ 2JPL X
15261lcnGb2JPK 2JPM X
15265Orf c02003 protein2JPU X
15267PW2 in DPC micelles2JQ2 X
15268ApoCIII2JQ3 X
15269ATC25212JQ4 X
15270RP30972JQ5 X
15271SMB domain from vitronectin2JQ8 X
15272M cono-toxin mr122JQB X
15273conopeptide mr12 mutant2JQC X
15275srp54 of archaeoglobus fulgius2JQE X
15277Leader Protease2JQF X
15278sLbpro2JQG X
15279EH domain of EHD1 in presence of Ca+22JQ6 X
15281CcR552JQN X
15288YobA 21-1202JQO X
15290Cog2p monomer2JQQ X
15295At3g28950.12JQV X
15299AgTx2-MTX toxin2Z3S X
15301CcV28C AdxL80C2JQR X
15302Odorrana2JQW X
15306C2 domain of Smurf22JQZ X
15312Aquifex NusB monomer2JR0 X
15313single polypeptide chain2KN6 X
15314HNS79c monomer2JR1 X
15315DDR2-DS2Z4F X
15317CPS 26112JR2 X
15318Pelovaterin2JR3 X
15319Unmodified ASLval32JR4 X
15320UPF0350 protein VC 24712JR5 X
15323moricin2JR8 X
15324RPA2121 doamin-swapped dimer2JRA X
15325CTD2JRB X
15327YqcC2HGK X
15329hr3872JRF X
15331(cmo5U34 M6A37)-ASL Val32JRG X
15332MEKK3 PB1-cis2JRH X
15334NtrC4 Receiver domain dimer2JRL X
15337SO03342JRO X
15338YfgJ monomer2JRP X
15339Ribosome Modulation Factor2JRM X
15341full length SiR902JRR X
15342(cmo5U34)-ASL Val32JRQ X
15343HR4730A2JRS X
15344RhR52JRT X
15345Blo t 52JRK X
15347NE00842K8S X
15348JARID1C2JRZ X
15349Nck1-2 SH32JS0 X
15350sr478 dimer2JS1 X
15351Nck1-1 SH32JS2 X
15352rpt8 dimer2JS3 X
15353BoR542JS4 X
15354NMR Structure of protein Q60C73 METCA2JS5 X
15356HR2869A2JS7 X
15357SNase complex2KHS X
15358caenopore5 monomer2JSA X
15359arenicin monomer2JSB X
15361mmp-202JSD X
15362(M6A37)-ASL Val32JSG X
15370apd monomer2JSN X
15371antimicrobial resistance protein2JSO X
15373Ros872JSP X
15374rubrdoxin monomer2QL0 X
15375rubrdoxin monomer2KKD X
15377DESR12JR7 X
15381NapD2JSX X
15382Huwentoxin-xi2JOT X
153844HB homodimer2JST X
15385F104W cTnC2JT0 X
15386str822JT1 X
15388F153W cTnC2JT3 X
15390HA Fusion Domain Mutant F9A2JRD X
15392KIA7F peptide tetramer2JO5 X
15393H2A.Z-H2B-Chz1 complex2JSS X
15394rpp mutation S173N2JOH X
15395MMP3 complex2JT5 X
15396MMP3 complex2JT6 X
15399rpp I214V2JOM X
15400F153(FTR) cTnC2JT8 X
15405RGD-hirudin2JOO X
15407CD2AP SH3-C monomer2JTE X
15410ubi2LD9 X
15411Single polypeptide chain2JSW X
15415monomer2JTM X
1541734mer RNA2JTP X
15418Complex of S100A6 and SIP(189-219)2JTT X
15419RPA34012JTV X
15423a single polypeptide chain2JTY X
15427F104(FTR) cTnC2JTZ X
15429LFABP-apo2JU3 X
15430PDEgamma2JU4 X
15431single polypeptide chain2JU5 X
15433holoLFABP2JU7 X
15434cpxLFABP2JU8 X
15437S836 monomer2JUA X
15438IP1*2JUB X
15439FF2JUC X
15440HasB2M2K X
15442TubCdd dimer2JUG X
15444DNA binding domain of NgTRF1 monomer2JUH X
15449ACP domain from rat2PNG X
15450ThrA3-DKP-insulin2JUM X
15451OST domain in GABP alpha2JUO X
15453FBP28WW2-PPLIPPPP2JUP X
15454ALOA3-DKP-insulin2JUU X
15455AbaA3-DKP-insulin2JUV X
15456dimer2JUW X
154571655-18222KBB X
15462HI0947 Homodimer2JUZ X
15464Human Insulin Monomer2JV1 X
15465Ph1500N2JV2 X
15466PinA WW domain2JV4 X
15471Peptidyl-tRNA hydrolase domain protein2JVA X
15476SR384-1-462JVD X
15477Prod12JVE X
15478M72JVF X
15480w60g-b2m2VB5 X
15485Npl3 RRM12JVO X
15487Npl3p RRM22JVR X
15490NusG2JVV X
15491VfR1172JVW X
15499ZF:ZN2JVX X
15500ZF-C417F:ZN2JVY X
15504MxiM - MxiD complex2JW1 X
15507Mip-rapamycin complex2VCD X
15509CPH domain monomer2JUF X
15511C-terminal dimerization domain of SARS coronavirus nucleocapsid protein2JW8 X
15512Palladin Ig3 domain2LQR X
15524RLIP762KWH X
15528ePABP2-trp2JWN X
15532wt1-17mer2JP9 X
15533wt1-zf14-14mer2JPA XX
15535Ga882JWS X
15536EnHD2JWT X
15537Gb882JWU X
15538RNA apatamer2JWV X
15542yajI2JWY X
15543rna bound nelfe-rrm2JX2 XX
15547GlUb(S27a)2JX5 X
15550hPCIF1 WW domain monomer2JX8 X
15553Gal lectin2JX9 2JXA X
15554Eps15 EH2-Stonin2 complex2JXC X
15555SPINK2 monomer2JXD X
15559NS4B2JXF X
15562Ymr074cp (1-116) monomer2JXN X
15567PDZ domain2JXO X
15568NeR45A2JXP X
15571RNA DUPLEX2JXQ X
15572RNA DUPLEX CONTAINING SINGLE ADENOSINE BULGE2JXS X
15573Protein LX2JXT X
15574KP-TerB2JXU X
15575FBP21 entity2JXW X
15576NFATC2IP Ubh monomer2JXX X
15578MMP12 HUMAN2JXY X
15579NS22JY0 X
15584STR2202JY9 X
15585ATU18102JYA X
15591P62 UBA2JY7 2K0B X
15592P62 UBA in complex with ubiquitin2JY8 X
15593C6orf1302LGR X
15596Human macrophage inflammatory protein 3alpha2JYO X
15601Atra-PBP12KPH X
15603LIPOPROTEIN SPR2K1G X
15604SgR42 protein2JZ2 X
15607At3g164502JZ4 X
15608VPA04192JZ5 X
15609ribosomal protein L282JZ6 X
15610BH098302JZ8 X
15611ewr120 protein2JZA X
156135'-D(*(DA)P*(DA)P*(DT)P*(DC)P*(DT)P*(DT)P*(DT)P*(DA)P*(DA)P*(DA)P*(DG)P*(DA)P*(DT)P*(DT))-3'2K4L X
15614complex2JZB X
15615F0F12KMA X
15617alg132JZC X
15618nsp3(527-651)2JZD X
15622antilipopolysaccharide factor2JOB X
15623CaBP12K7D X
15624CaMCaNp2JZI X
15632TCS C-domain2JZY X
15633CXCL12/SDF1-alpha2K01 X
15634FeoC monomer2K02 X
15635CXCL12/SDF1-alpha, CXCR42K03 X
15636CXCL12/SDF1-alpha, CXCR42K04 X
15637CXCL12/SDF1-alpha, CXCR42K05 X
15638Rv1567c monomer2N48 X
15642NusG2K06 X
15644Rds32K0A X
15645Im7 mutant2K0D X
15651KpOmpA transmembrane domain2K0L X
15652RrR432K0M X
15655CopK2K0Q X
15658actinorhodin polyketide acyl carrier protein2K0X X
15659actinorhodin apo acyl carrier protein2K0Y X
15660LFV-Z2M1S X
15661hp12032K0Z X
15663CaBP3 monomer2LC5 X
15665ranatuerin-2CSa2K10 X
15670TAF3-PHD finger2K16 X
15671TAF3-PHD finger2K17 X
15673PisI2K19 X
15674chromobox protein homolog 72K1B X
15676prion protein2K1D X
15677water-soluble analogue of KcsA2K1E 2KB1 X
15678SeR132K1H X
15679MyBP-C2K1M X
15683YiaD2K1S X
15687TA08952K22 X
15688TA09562K24 X
15689UBB2K25 X
15691RelB2K29 X
15693Pax8 paired Box Domain2K27 X
15695chromobox protein homolog 42K28 X
15698Lethocerus F1 troponin C isoform2K2A X
15700human N-termal doamin of pirh22K2C X
15701human C-termal doamin of pirh22K2D X
15702BP27862K2E X
15704S100A1 bound to calmodulin2K2F X
15707split PH domain from Phospholipase C gamma 22K2J X
15710Eps8L1SH32K2M X
15716AlgE6R12ML1 X
15717CYANOBACTERIAL PHYTOCHROME GAF2LB9 X
15718myoferlin2K2O X
15721ATU12032N4D X
15723nsp3(1066-1181)2K87 X
15728EphA1 TM dimer2K1K X
15729Tick Carboxypeptidase Inhibitor2K2X X
15730intermediate IIIa of Tick Carboxypeptidase Inhibitor2K2Y X
15731Tick Carboxypeptidase Inhibitor2K2Z X
15734Phosphodiesterase 52K31 X
15735AcrA2K32 X
15737AcrA(61-210DD) glycosylated2K33 XX
15740protein K7 from the Vaccinia virus2K36 X
15742CsmA2K37 X
15743Hahellin2KP5 X
15744Lipid-free human apolipoprotein E2L7B X
15745HBV stem-loop alpha;2JYM X
15746BPP3783 115-1202JPF X
15747TMIX peptide2K3C X
15750Lin03342K3D X
15752ILTat1.24 C2 domain2JWH X
15753ILTat1.24 C1 domain2JWG X
15762SfR902K3I X
15763Human Mia402K3J X
15765Tetraheme Cytochrome from Shewanella Frigidimarina2K3V X
15774Rv1761c2K3M X
15775The transmembrane C-terminal domain of the Amyloid Precursor Protein2LP1 X
15776Rpp21-Zn2K3R X
15777FLNA232K3T X
15778CHIPS-C5aR(P7-28S)2K3U X
157805'-R(*GP*UP*CP*GP*AP*GP*CP*UP*G)-3'2K3Z X
157815'-R(*GP*UP*CP*GP*UP*GP*CP*UP*G)-3'2K41 X
15783FGF-12K43 X
15785C2A2K45 X
15790ANDES HANTAVIRUS NUCLEOCAPSID PROTEIN2K48 X
15791SoR1902K49 X
15793CopR-NTD2K4B X
15796E2-c-Cbl2K4D X
15797monomer2JSZ X
15798Tpx monomer2JSY X
15801ArsR2K4J X
15804TR8 protein2K4M X
15805PA02462K4N X
15807gpV2K4Q X
15810PA10762K4V X
15811S27A2K4X X
15812FeoA-like protein2K4Y X
15816DsrR2K4Z X
15819TR91A2K50 X
15821MJ11982K52 X
15823Atu07422K54 X
15825PsR76A2K57 X
15828PF03852K5C X
15829SaR322K5D X
15833GsR1952K5E X
15834FeoA protein2K5F X
15835BpR1952K5G X
15836tt824a2K5H X
15837IRON(II) TRANSPORT PROTEIN A2K5I X
15839yiiF2K5J X
15841Protein FeoA2K5L X
15843ECA15802N49 X
15844GmR1372K5P X
15845Prion Protein2K5O X
15847XF26732K5R X
15849MrR110B2K5V X
15850BcR103A2K5W X
15851Stromal interaction molecule 12K60 X
15852calmodulin2K61 X
15854bile acid-based Gd(III)-chelate and bile acid protein complex2K62 X
15855Gadd45a2KG4 X
1585829-MER2K65 X
1585929-MER2K66 X
158605'-D(*DTP*DTP*DAP*DAP*DTP*DTP*DTP*(D33)*(D33)*(D33)*DAP*DAP*DAP*DTP*DTP*DAP*DA)-3'2K67 2K68 2K69 X
15863EAS D152K6A X
15864pdcd52K6B X
15866CIN85 Sh3-C domain/ubiquitin complex2K6D X
15870H1-47 subunit A ATP synthase2K6I X
15873Supervillin Headpiece2K6M X
15874Supervillin Headpiece2K6N X
15876LL-372K6O X
15877LC3/p62 complex2K6Q X
15879FSD mod2K6R X
15880Rab11-FIP22K6S X
15893CuA center2K6V X
15894CuA center2K6W X
15896copper loaded form PCuA2K6Z X
15897PCuA2K70 X
15900MMP23-BgK2K72 X
15902Ta03872K75 X
15912Itk SH3 and Itk SH2 domains2K79 X
15913IsdC2K78 X
159155'-R(*GP*CP*GP*GP*UP*GP*UP*AP*AP*AP*AP*G)-3'2K7E X
15916ATU02322K7I X
15919RAP74/FCP1 complex2K7L X
15922PPIL1/SKIP2K7N X
15923rat S100B2K7O X
15924FLNa16-172K7P X
15925FLNa18-192K7Q X
15926DnaI N-domain2K7R X
15928ARNT PAS-B Slipped IB Strand2K7S X
15931E2plipD4 dimer2K7V X
15932Procaspase-82K7Z X
15938p190-A RhoGAPFF12K85 X
15939FOXO3a2K86 X
15941Methionine Sulfoxide Reductase2K8D X
15943yegP2K8E X
15944Taz2-p53 TAD12K8F X
15946pGolemi2K76 X
15948RING Finger monomer2KIZ X
15950E.Coli SlyD2K8I X
15951p72K8J X
15956BMPR-IA2K3G X
15958Shq1p2K8Q X
15961M2AP2MPO X
15964ERp182K8V X
15965TM1b(1-19)Zip/TM9d252-284 complex2K8X X
15966DsbB2K73 X
15977CdnLC2LT3 X
15981Cgi1212K8Y X
15983ShK-1922K9E X
15987ORF562K9I X
15988TonB2-CTD2K9K X
15989Myb12K9N X
15992Vm242K9O X
15995TM1 TM2 in LPPG micelles2K9P X
15996complement component C72WCY X
15999HTH 32K9Q X
16001AraC-DBD2K9S X
16002Migfilin2K9U X
16005EphA2 TM dimer2K9Y X
16006TM11122K9Z X
16007TM13672KA0 X
16012Bcl2/Adenovirus E1B 19 kDa protein-interacting protein 32KA1 X
16014TAZ1/STAT2 complex2KA4 X
16015TAZ2/STAT1 complex2KA6 X
16016TM02122KA7 X
16019TM10812KA5 X
16020M2 Transmembrane Peptide2KAD X
16024Ga-substituted Ferredoxin2KAJ X
16025Ec-1 metallothionein2KAK X
16027INSULIN A CHAIN, INSULIN B CHAIN2K91 X
16028CD3OH2KAM X
16029At2g323502N4F X
16030BPP29142KAT X
16032NaV1.2 C-terminal EF-hand domain2KAV X
16033S100A52KAX X
16034S100A52KAY X
16037BlrP1 BLUF2KB2 X
16038pOdhI2KB3 X
16039OdhI2KB4 X
16040onconase C87A/C104A2KB6 X
16045hH12KBI X
16050Ca-S100A1 and TRTK122KBM X
16051MM02932KBN 2KEN X
16053PROTEIN2KBT X
160545'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'2K90 X
160555'-D(P*TP*CP*GP*TP*TP*GP*CP*T)-3'2K97 X
16056TMXI2KBV X
16057gp152KBZ X
16058Factor H-binding Protein2KC0 X
16061HybE2KC5 X
16062En-12KC6 X
16063ILK/PINCH complex2KBX X
16064BF16502KC7 X
16065RelE:RelBc complex2KC8 X
16066RelE2KC9 X
16068gp162KCA X
16072SSP00472KCD X
16073cycloviolacin O22KCG X
16074kalata B22KCH X
16082FAPP1-PH2KCJ X
16083MrR121A2KCK X
16084SRU 01032KCL X
16085ACP single polypeptide chain2ML8 X
16087PAF2KCN X
16089sso01642KCO X
16090foldon E5R2KBL X
16091rps82KCP X
16093SRU 20402KCQ X
16094anntoxin2KCR X
16096DvR115G2KCT X
16097CtR1072KCU X
16098Apo-form YjaB2KCW X
16099FSTL-32KCX X
16100DR A00062KCZ X
16101AR3445A2KD0 X
16102BcR268F2KD1 X
16103FAIM-CTD monomer2KD2 X
16107btr324b2KD7 X
16109Herpud2 9 852KDB X
16110Borealin2KDD X
16111Art v 1- the major allergen of Artemisia vulgaris2KPY X
16114Ubiquitin/UIM fusion protein2KDI X
16116Ga952KDL X
16117Gb952KDM X
16118PFE0790c2KDN X
16119SBDS2KDO X
16122HCV NS4B(227-254)2KDR X
16126HypA2KDX X
16127SAP30 ZnF2KDP X
16129CIP42KE4 X
16135CcdB homodimer2KMT X
16136jerdostatin polypeptide2W9O X
16137AIDA12KE7 X
1613834-MER, SILVER ION2M54 X
16139caskinSH32KE9 X
16141HACS1 SH3 domain6UZJ X
16142CXCL12/SDF1-alpha2KEC X
16143CXCL12/SDF1-alpha2KED X
16145CXCL12/SDF1-alpha2KEE X
16147Trx2MMO X
16148PlnK2KEG X
16149PlnK2KEH X
16150jerdostatin R24K2W9U X
16151jerdostatin -N45G46 polypeptide2W9V X
16152jerdostatin R24K -N45G46 polypeptide2W9W X
16153SvtR082KEL X
16154MM02932KEN X
16155HS000592KEO X
16156Synphilin-12KES X
16157Parvulustat2KER X
16161BfR257C2KEY X
16164XcpT2KEP X
16168PHOSPHOLEMMAN2JO1 X
16170Barnase2KF4 X
16171Barnase2KF5 X
16172barnase2KF6 X
16173p23t2KFB X
16176Prp40-FF42KFD X
16178MeVamp-42KFE X
16179EHD1 with FNYESTNPFTAK2KFF X
16180EHD1/FNYESTNPFTAK complex2KFG X
16181EHD1 with FNYESTGPFTAK2KFH X
16183Tammar Wallaby Prion Protein (121-230)2KFL X
16184Mouse Prion Protein (121-231)2KFM X
16185Mouse Prion Protein (121-231)2KFO X
16186PSPTO 30162KFP X
16187FP12KFQ X
16188Rv2175c2KFS X
16189FKBP3-N2KFV X
16190cNTnC and WW72KFX X
16191Monomer2KLE X
16193hnRNP F/AGGGAU G-tract RNA complex2KG0 XX
16194hnRNP F/AGGGAU G-tract RNA complex2KG1 XX
16195AKAP13-PH2LG1 X
16196acetyl Actinorhodin Acyl Carrier2KG6 X
16197malonyl ACP2KG8 X
16199butyryl-ACP2KG9 X
16200hexanoyl ACP2KGA X
16201octanoyl ACP2KGC X
162023-oxo-butyl-ACP2KGD X
162033,5-dioxohexyl ACP2KGE X
16207NmerA2KT2 X
16208NmerAHg2KT3 X
16209JARID1A PHD finger 32KGG X
16210JARID1A PHD finger 32KGI X
16211PpiD2KGJ X
162125'-D(TP*CP*GP*TP*TP*GP*CP*T)-3'2K8Z X
16214Zn finger protein YBIL2KGO X
16215wt-brazzein2LY5 X
16219PTK6-SH32KGT X
162225'-D(*DCP*DTP*DAP*DTP*(FAG)P*DAP*DTP*DTP*DCP*DA)-3'2KH3 X
162235'-D(*DCP*DTP*(FAG)P*DA)-3'2KH4 X
162255'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'2KH6 X
162265'-D(*DGP*DTP*DGP*DCP*DGP*(TG)P*DGP*DTP*DTP*DTP*DGP*DT)-3'2KH7 2KH8 X
16230U6 snRNP (small fragment)2KH9 XX
16231Pathogen Recognition Domain from Plodia interpunctella2KHA X
16233Eimeria tenella microneme protein 3 mar1a domain2LBO X
16235linear kalata B12KHB X
16236Bruno RRM3+2KHC X
16237OmpATb2KGS X
16238VC A09192KHD X
16239Plantaricin J2KHF X
16240SlyD2KFW X
16241Plantaricin J2KHG X
16243Prp24-RRM232KH9 X
16244U6 snRNP (fragment)2KH9 XX
16246Prp24-RRM22KH9 X
16247F1Fo ATP synthase2KHK X
16248PknB-phosphorylated Rv18272KFU X
16249NR3 dimer2KHM X
16250human intersectin-12KHN X
16251syr103b protein2KHQ X
16252A132L7Z X
16253Rv2377c2KHR X
16254Microcrystalline HNP-12KHT X
16255Nmul A09222KHV X
16256Drosha2KHX X
16258RCL2KHZ X
16260PvFKBD2KI3 X
16263NLRP7 Pyd monomer2KM6 X
16264Glutaredoxin2KHP X
16267tungsten formylmethanofuran dehydrogenase subunit D2KI8 X
16268cannabinoid receptor-2 helix 62KI9 X
16269n-NafY2KIC X
16270Sortase A-substrate complex2KID X
16271OCRL bridges clathrin-mediated membrane2KIE X
16272VpR2472KIF X
16273OCRL bridges clathrin-mediated membrane2KIG X
16276SO21442KII X
16277ATP7A2KIJ X
16278SO21442KIL X
16283VpR2472KIM X
16284y1fatc2KIO X
16285PDZ protein2KG2 X
16293CA150 FF1+linker2KIS X
16295y1fatc2KIT X
16297AIDA-1 SAM domain tandem2KIV X
16298SH10032KIW X
16306Truncated hemoglobin2KSC X
16311VEK-30/plasminogen kringle 2 complex2KJ4 X
16312mul A0064N2KJ5 X
16315putative phage integrase IntS2KJ8 X
16316IntB phage-integrase-like protein2KJ9 X
16317human interleukin-332KLL X
16318CBP TAZ2/Adenoviral E1A Complex2KJE X
16319Carnocyclin A2KJF X
16320SSO69042KJG X
16321UbcH82KJH X
16325lkr136b2KJK X
16332lah42KJN X
16333LAH42KJO X
16335BSU150502KJP X
16336NMB10762KJQ X
16338CG112422KJR X
16339LKAMG2KJL X
16344S6wt2KJV X
16345permutant P54-552KJW X
16347ATC08522KJZ X
16348DEAD RINGER-LIKE PROTEIN 12KK0 X
16349Tyrosine-protein kinase ABL22KK1 X
16350pheromone En-A12KK2 X
16352AF20942KK4 X
16353Proto-oncogene tyrosine-protein kinase FER2KK6 X
16354A1AO ATP synthase2KK7 X
16355AR3449A2KK8 X
163565'-D(*AP*GP*GP*GP*TP*TP*AP*GP*GP*GP*TP*TP*AP*(INO)P*GP*GP*TP*TP*AP*GP*GP*GP*T)-3'2KKA X
16357TR52KKE X
16361p62 PB12KKC X
16363CBP2KKJ X
16364Mb18582KKL X
16365YOR252W2KKM X
16366TM10762KKN X
16368Mb03322KKO X
16370Human Myotilin2KKQ X
16371DSY29492KKS X
16372af23512KKU X
16373SPA42882KKV X
16374NleG2-32KKX X
16375NleG2-32KKY X
16376OR8w187r2KKZ X
16377RPA35742LEK X
16378GtR34C2KL1 X
16380gi-138793692KL2 X
16381VDAC-12K4T X
16382Alr37902KL3 X
16384SR2322KL5 X
16385PF11092KL6 X
16386Human Fibulin-42KL7 X
16387OR152KL8 X
16388NsR431C2KLB X
16389NP 247299.12KLA X
16390ubiquilin 12KLC X
16396CBD2KLQ X
16397human ataxin-72KKR X
16400ABC collagen heterotrimer2KLW X
16403GLUTAREDOXIN2KLX X
16404Human ubiquitin-conjugating enzyme E2G2 isoform 12KLY X
16405Ataxin-3/Ubiquitin complex2KLZ X
16408periplasmic CopK protein complex2KM0 X
16411Rtt103 CTD interacting domain2KM4 X
16413C17orf372LJK X
16425rna15, hrp1, anchor RNA 3' processing ternary complex2KM8 XX
16426murine Ets-12KMD X
16428KlcA and ArdB proteins2KMG X
16431TAR-2Lig2KMJ XX
16436LDTI - IIa2KMO X
16437LDTI - IIb2KMP X
16438LDTI - IIc2KMP X
16439factor H (modules 10-15)2KMS X
16440human Menkes protein2KMV X
16441ATP-bound N-MNK2KMX X
16442At3g03773.12KMW X
16443cytochrome c32KMY X
16449XPF DNA complex2KN7 XX
16452pUL892KN8 X
16465CaM-peptide2KNE X
16466plasminogen kringle 52KNF X
16467AML1-ETO/HEB peptide complex2KNH X
16468PcTx12KNI X
16472TENC12KNO X
16476ATC09052KNR X
16477e1 peptide2KNU X
16478UBA2KNA X
16480LDLR2LGP X
16482LRP-12KNX X
16483CR17 from LRP-1 and ApoE2KNY X
16484CIP75 UBA2KNZ X
16485THAP RRM12KO0 XX
16486GTP pyrophosphokinase2KO1 X
16490sf39292KO6 X
16491peptidyl-prolyl cis-trans isomerase/Cycloheximide-N-ethylethanoate complex2KO7 X
16492Anti-TRAP2KO8 X
16496integrin alphaIIb beta3 transmembrane-cytoplasmic heterocomplex2KNC X
16497Integrin aIIbb3 transmembrane complex2K9J X
16498CLOLEP 018372KOB X
16504Human cannabinoid receptor 1 - helix 7/8 peptide2KOE X
16505octarepeats2KKG X
16507MmPar3 PDZ3, MmVE-Cadherin2KOH X
16510first PHD finger/non-modified histone H3 tail complex2KE1 X
16515mPar3 PDZ22KOJ X
16517BR72KOK X
16519SDF1a H25R2KOL X
16520hPar3 PDZ22KOM X
16521CV 21162KON X
16524Modified Fatty Acid Synthase Acyl Carrier Protein2KOO X
16525Modified Fatty Acid Synthase Acyl Carrier Protein2KOP X
16526Modified Fatty Acid Synthase Acyl Carrier Protein2KOQ X
16527Modified Fatty Acid Synthase Acyl Carrier Protein2KOR X
16528Modified Fatty Acid Synthase Acyl Carrier Protein2KOS X
16534DCL4 DUF2832KOU X
16536Wilson Disease Associated Protein2KOY X
16539nasonin-12KOZ X
16540nasonin-1M2KP0 X
16544RECQL42KMU X
16545CV02372KP6 X
16549Mus81 NTD2KP7 X
16550ARNO(375-400)2KPA X
16551ARNO-p2KPB X
16556SCO30272KPI X
16557ErR9A2KPJ X
16558MAGI-1 PDZ12KPK X
16559MAGI-1 PDZ1 / E6CT2KPL X
16560protein from gene locus NE06652KPM X
16561BcR147A2KPN X
16562ROSSMANN 2x2 FOLD PROTEIN2KPO X
16563Lin04312KPP X
16564Atu12192KPQ X
16569cgr26a2KPT X
16570YbbR family protein Dhaf 08332KPU X
16572Lamin-B12KPW X
16574NEDD4 3RD WW DOMAIN/HUMAN T-CELL LEUKEMIA VIRUS complex2KPZ X
16575NEDD4 3RD WW/ILPTAPPEYMEA complex2KQ0 X
16576Protein BH0266 From Bacillus halodurans2KQ1 X
16577Homeodomain DNA complex2LD5 XX
16578DSY17902KQ2 X
16585SNase1402KQ3 X
16589PthA2KQ5 X
16590EF-hand domain of polycystin-22KQ6 X
16592BT9727 49152KQ8 X
16594atc08882KQ9 X
16596APLF2KQB 2KQC 2KQD 2KQE X
16603IscU2KQK X
16605MAUROCALCINE2KQL X
16606kI O18/O8 Y87H2KQM X
16607AL-09 H87Y2KQN X
16608Proinsulin2KQP X
16610AsnRS2KQR X
16612M2-TM amt2KQT X
16617ATH2KQY X
16620hs001842KR1 X
16621KCNE32NDJ X
16624acyl carrier protein from a fungal type I polyketide synthase2KR5 X
16629SlyD2KR7 X
16632Kalirin2KR9 X
16633prokineticin Bv82KRA X
16636ComAC2KRF X
16637PDZ2-2702KJD X
16638NHERF1 (150-358)2KRG X
16639V of beta2-glycoprotein I and ligand-binding module complex2KRI X
16640HR3102A2KRK X
16641CD2AP SH3-A monomer2KRM X
16642CD2AP SH3-B monomer2KRN X
16643CD2AP SH3-C monomer2KRO X
16646RBD1,2 domains from human nucleolin2KRR X
16647CPF 05872KRS X
16648UuR17A2KRT X
16649CtR69A2KRU X
16652asl35972KRX X
16653HtrA PDZ2L97 X
166545'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*(N)P*AP*UP*AP*CP*CP*CP*CP*GP*A)-3'2KRY X
166555'-R(*(PSU)P*CP*GP*GP*GP*CP*CP*CP*AP*UP*AP*CP*CP*CP*CP*GP*A)-3'2KRZ X
16656Q251Q8 DESHY2KS0 X
16660Substance P-NK1 complex2KS9 X
16662AeSCP-22KSH X
16663HUMAN INSULIN MUTANT2KQQ X
16665AeSCP-2-PA2KSI X
16667TaITX-16URP X
16671EH-domain proteins with specific NPF-containing partners2KSP X
16672transmembrane domain of the n-acetylcholine receptor beta2 subunit2KSR X
16674cytochrome c32KSU X
16675protein-glutaminase2KSV X
16676Oryctin2KSW X
16677interferon-receptor complex2LAG X
16678Sensory Rhodopsin II2KSY X
16679GNA 21322LFU X
16680Nanog2KT0 X
16681HR5531E2KT1 X
16682Q83/[GaIII(Ent)]3-2KT4 X
16683REF2-I/HSV-1 ICP27 peptide2KT5 X
16684MS12KT6 X
16686lmo08352KT7 X
16688CPE12312KT8 X
16691SgR462KT9 X
16692BvR106A2KTA X
16693BTK22KTC X
16694Human Polybromo/Histone 3 complex2KTB X
16701the C-terminal domain of Stt3p2LGZ X
16709LchB2KTN X
16711NP 415897.12KTS X
16714AUCG tetraloop hairpin2Y95 X
16715Vaccinia Related-Kinase 12LAV X
16719Crammer2L95 X
16720mouse prion protein mutant D167S2KU4 X
16721BRD1 PHD1 finger2KU3 X
16722mouse prion protein double mutant D167S, N173K2KU5 X
16723mouse prion protein double mutant D167S, N173K2KU6 X
16731putative disulphide-isomerase2KUC X
16732PknB PASTA122KUD X
16733PknB PASTA232KUE X
16734PknB PASTA342KUF X
16737NMB13432KXI X
16738VRK12KUL X
16743HuPrP(90-231 M129 Q212P)2KUN X
16744APLF2KUO X
16745Sm-AMP-1.1a monomer2KUS X
16746GmR58A2KUT X
16747Glycocin A2KUY X
16764CALMODULIN2KUG 2KUH X
16767Reg IV2KV3 X
16768hEGF2KV4 X
16770PrgI mutant2KV7 X
16771alphaIIb beta32KV9 X
16772CI-MPR domain52KVA X
16773CI-MPR domain52KVB X
16774Rv0543c2KVC X
16778CBX7/H3K27me2 complex2KVM X
16779Lmo2-LIM2/Ldb1-LID2LXD X
16782Photosystem II reaction center Psb28 protein2KVO X
16788NusG:NusE2KVQ X
16789usp7-ubl12KVR X
16790CV08632X8N X
16791yaiA2KVT X
16792SAP domain of MKL/myocardin-like protein 12KVU X
16794ZR2152KVS X
16795KpR492KVV X
16797mTZD finger22KVH X
16801lmo08352KVZ X
16802CcmH2KW0 X
16805RpR3242KW2 X
16806SgR1452N47 X
16807DhR1A2KW4 X
16808HR3057H2KW6 X
16809Itk SH3 and Itk SH2 domains2K7A X
16810PgR37A2KW7 X
16811SrtA2KW8 X
16812MED1:DNA complex2KAE XX
16813complex of Ubl and SH32KNB X
16816HR4547E2KW9 X
16817dermcidin-1L2KSG X
16818PFUC trans2K8A X
16820S8E2KCY X
16821SRU 01032KCV X
16822Bacillus anthracis dihydrofolate reductase2KGK X
16824WASP/EspFU complex2K42 X
16831C-domain of Lsr22KNG X
16832C-terminal domain from mtTyrRS2KTL X
16833WR732LOY X
168345'-D(*DGP*DCP*DGP*DAP*DGP*(6MT)P*DTP*DCP*DTP*DGP*DCP*DG)-3'2KAL X
16835Atg82KWC X
16839chemokine CCL272KUM X
16840darcin2L9C X
16842PpcA2LDO X
16843Abp1p2K3B X
16846Rv08992KSM X
16849rubredoxin2KKD X
16851KIX ETAD12KWF X
16852siRNA construct2KWG X
16853CD4mut2KLU X
16856acyl carrier protein2KWL X
16857Exon 6 of human Jagged-12KB9 X
16860holo acyl carrier protein2LML X
16861Tandem PHD finger of Human DPF3b2KWN X
16862CaBP12LAN X
16864uvi31+5ZB6 X
16865Tandem PHD finger of Human DPF3b2KWO X
16868NusA2KWP X
16871ZO-1 PDZ22JWE X
16872Mcm10 C-terminal DNA binding domain2KWQ X
16878Reecognition of H3 by the PHD Finger2KFT X
16879PDZ3 PTP-BL6GBE 6GBD X
16880UBM2 in Complex with Ubiquitin2KWU X
16881polyketide cyclase SCO53152KF2 X
16882Ubiquitin-Binding Motif2KHU X
16884RRM3 monomer2MY8 X
16885UBM1-Ubiquitin complex2KWV X
16886HCV NS2 [27-59]2KWT X
16887HIV-2 unmyristoylated matrix protein2K4E X
16888HIV-2 myristoylated matrix protein2K4H X
16889HIV-2 myrMA bound to di-C4-PI(4,5)P22K4I X
16892NS2[60-99]2KWZ X
16895UBB+1 (ubiquitin B mutant)2KX0 X
16897MTH18212KX2 X
16899UBL domain of UBLCP1, I5M2KX3 X
16901Human Relaxin-like Factor2K6T X
16905Sma0114, response regulator2LPM X
16907HAfp2KXA X
16909IRTKS-SH3 and EspFu-R47 complex2KXC X
16911VARC2442LKL X
16912delta2M4K X
16913squash aspartic acid proteinase inhibitor2KXG X
16915Human Insulin Mutant A22Gly-B31Lys-B32Arg2KXK X
16920Tra2beta1 RRM in complex with AAGAAC RNA2KXN XX
16922histidine kinase receptor KdpD2KSF X
16923Smurf2 WW2 and WW3 bound to Smad7 PY2KXQ X
16926E. coli lipoprotein2KXX X
16927protein sur18c2KXY X
16929TerD-CA2+2KXV X
16934PBS domain2KY4 X
16935PECAM-12KY5 X
16936MBD2 bound to a methylated DNA2KY8 XX
1694147-MER2KX5 XX
16942SR5182KY9 X
16943PatE1-342KYA X
16944CpR82G2KYB X
16945chicken parvalbumin 32KYC X
16947histidine kinase receptor ArcB2KSD X
169505'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'2KXZ X
169515'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'2KY0 X
169525'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'2KY1 X
169535'-R(*GP*AP*CP*AP*AP*GP*UP*GP*UP*CP*A)-3'2KY2 X
16954NHR3/PKA(RIIa) Complex2KYG X
16955calcium-bound CPV32KYF X
16956AlgE6R32ML3 X
16957KvAP2KYH X
16960Solution structure of GxTX-1E2WH9 X
16961Dsy0195(21-82) protein2KYI X
16963U1-Liotoxin-Lw1a2KYJ X
16967MAST2-PDZ/PTEN-C Terminus2KYL X
16968Derivative of HRF2K6U X
16969Sam68 Qua1 domain2XA6 X
16970Bem1p SH3-CI domain with Ste20p2KYM X
16971TraI 381-5692L8B X
16977nsp7a2L8K X
16978CKR-brazzein2KYQ X
16979ec05442KYR X
169805'-R(*CP*UP*AP*GP*UP*UP*AP*GP*CP*UP*AP*AP*CP*UP*AP*G)-3'2KYD X
16981SARS Coronavirus Nonstructural Protein Nsp72KYS X
16983PHD3 finger of MLL2KYU X
16986DP1 subunit2KXE X
16988PtR41O2KYW X
16989CYP332KYX X
16991NeR70A2KYY X
16994C-Terminus Calmodulin F92E2KZ2 X
16995bolA protein (ECH 0303)2KZ0 X
16996human Rad51D N2KZ3 X
16997SF11412KZ4 X
16998HR4653B2KZ5 X
16999CV04262KZ6 X
17000E1-69 of Yeast V-ATPase2KZ9 X
17001ASIP(80-132, P103A, P105A, Q115Y, S124Y)2KZA X
17002YP 510488.12KZC X
17005trPRAI2KZH X
17006Atg192KZB X
17007Alpha-mannosidase binding domain of Atg342KZK X
17008SR102KZN X
17011E2[296-331] segment of Hepaptitis C Virus2KZQ X
17014ChxR monomer2M1B X
17015CUPIENNIN 1A2K38 X
17016CARMIL CAH3a/b domain bound to capping protein2KZ7 X
17017MmT2A2KZR X
17018DAXX helical bundle2KZS X
17019DAXX / Rassf1C complex2KZU X
17020CV 0373(175-257) protein2KZV X
17021MaR143A2KZW X
17022CmR1162KZX X
17023Znf A202KZY X
17024Znf A20:ubiquitin complex2L00 X
17025BvR1532L01 X
17026BtR3752L02 X
17028Bacteriophage Lambda Tail Tube-gpV-C2L04 X
17030HR4694F2L05 X
17031SLR03352L06 X
17032CKR-PNG2L07 X
17033Nonsense mRNA reducing factor2L08 X
17035asr41542L09 X
17038SlR1152L0C X
17039MvR254A2L0D X
17040TM VI2L0E X
17044Rtt103 CTD complex2L0I X
17045KSR1 CA1 monomer2LPE X
17050Solution structure of the Tudor domain from Drosophila Polycomblike (Pcl)2XK0 X
17062hPgn rK32L0S X
17066N-Terminal PAS Domain of HERG K Channel2L0W X
17067Complex hMia40-hCox172L0Y X
17070talin domain C2L10 X
17071Cbx3 H3K9me3 complex2L11 X
17072Cbx7 H3K9me3 complex2L12 X
17073CBP in complex with p53 TAD2L14 X
17074SynArsC2MYP X
17076SynArsC2MYN X
17077SynArsC2MYT X
17079PROTEIN2L1B X
17080Shc-PTB complex with Integrin beta32L1C X
17081Prion with Y169G mutation2L1D X
17082mouse prion protein with mutation F175A2L1E X
1708365-MER2L1F X
17086ASIP(93-126, P103A, P105A, P111A, Q115Y, S124Y)2L1J X
17087Prion with Y169A, Y225A, Y226A mutation2L1K X
17088P6.1 hairpin2KYE X
17089SH3 monomer2KXD X
17090YP 399305.12L1N X
17091PROTEIN2L1O X
17092DNA-binding protein SATB12L1P X
17103calcium-sensitizer, dfbp-o, in complex with troponin C and the switch region of troponin I2L1R X
17104YP 0013362052L1S X
17105NP 954075.12L1T X
1710636-MER, 7-DEAZA-7-AMINOMETHYL-GUANINE2L1V X
17107Human Insulin Mutant2L1Y X
17108Human Insulin Mutant2L1Z X
17110IGF2R2L21 X
17111Mupirocin didomain ACP2L22 X
17124NP 888769.12L25 X
17125apo DHFR2L28 X
17127IGF-II in complex with the mutant form of human domain 112L29 X
17132amino-terminal UBA domain of OTUD7A2L2D X
17138MBD2/p66-alpha complex2L2L X
17143HYL1 dsRBD 12L2N X
17145Pitx2 homeodomain R24H2L7M X
17147Pitx2 homeodomain2L7F X
17149Fyn SH3 A39V-N53P-V55L2L2P 2LP5 X
17150phosphotransferase IIB2L2Q X
17151FKBP in complex with 1-{[(4-methylphenyl)thio]acetyl}piperidine2L2S X
17152EcAMP12L2R X
17153thiostrepton2L2W X
17154Thiostrepton(oxi,9)2L2X X
17155Thiostrepton(epi,9)2L2Y X
17156Thiostrepton(red,14)2L2Z X
17157PARP-1 Finger 12L30 X
17158PARP-1 Finger 22L31 X
17160CBP212LHS X
17161Rna14p/Rna15p2L9B X
17165WT2XKS X
17166dN62XKU X
17169HR4527E2L33 X
17173Nrd1 CID2LO6 X
17174Mouse prion protein2L39 X
17175SP 0782 homodimer2L3A X
17176BT 0084 lipoprotein2L3B X
1718835-MER2L3E X
17191MvR762L3F X
17193SEVI precursor peptide PAP2L3H X
17194Oxki4a2L3I X
17196Cu-binding protein2L3M X
17199spRT62L3N X
17200UHRF1 Tandem Tudor Domains/Histone H3 complex2L3R X
17202Tandem SH2 domains of Spt62L3T X
17203Acyl carrier protein2N57 X
17213Mouse prion protein (121-231) with the mutation Y169A2L40 X
17227GS-alfa-Ktx5.4 SCORPION TOXIN2KY3 X
17228ZNF2L44 X
17229ZNF DNA2L45 XX
17232PlyG (E.C.3.5.1.28)2L47 X
17233PlyG2L48 X
17234Lrp DNA-binding domain2L4A X
17235ACP182L4B X
17236Sco proteins2L4D X
17237hFn142KMZ X
17238UBA2L4E X
17239UBA+Ub complex2L4F X
17240Influenza HA fusion peptide(G13A)2L4G X
17241YAP2L4J X
17242Thioredoxin C2L4Q X
17243PROTEIN2KDH X
17244PROTEIN2L43 X
17245CCL21 SLC 6Ckine Exodus-22L4N X
17246DOMAIN OF A CELL WALL SURFACE ANCHOR FAMILY PROTEIN2L4O X
17247xeFn142KN0 X
17249R22ML2 X
17252BCMA2KN1 X
17254GIP apo2L4S X
17255GIP/Glutaminase L peptide complex2L4T X
17256PROTEIN STE52L4U X
17257VirB7-Xac2622 monomer2L4W X
17258Pineapple Cystatin2L4V X
17260UCHL1 S18Y variant2LEN X
17261APO S100A162L50 X
17262Calcium bound S100A162L51 X
17263Small archaeal modifier protein 1 from Methanosarcina acetivorans2L52 X
17264calmodulin IQ motif complex2L53 X
17265Fusion protein2L4Z X
17266SilB(440-521)2L55 X
17267uncharacterized thiredoxin-like protein2L57 X
17268Thioredoxin C2L59 X
17270Brd3 in complex with GATA-1 C-tail2L5E X
17271complex of GPS2 53-90 and SMRT 167-2072L5G X
17272Human PIWI-like 1 PAZ domain2L5C X
17273human PIWI-like 1 PAZ domain with ssRNA (5'-pUGACA)2L5D XX
17275thioredoxin2L5L X
17277putative thioredoxin2L5O X
17278TgADF Monomer2MOT X
17279rat epididymal lipocalin 122L5P X
17280BvR1592L5Q X
17281Alyteserin-1C2L5R X
17282IscU2L4X X
17283Pae1772LJ6 X
17284E2 lipoyl domain2L5T X
17286hRpn132L5V X
17287M6P/IGF2 receptor2LLA X
17288SaMazF2MF2 X
17289Stromal Interaction Molecule 22L5Y X
17291PYY2L60 X
1729226-MER2L5Z X
17294EC PROTEIN I/II2L61 X
17295EC PROTEIN I/II2L62 X
17296GLP-22L63 X
17297GLP-22L64 X
17298sso11182MDT X
17300thioredoxin6ZOM X
17302human liver fatty acid binding protein2L67 X
17303human liver fatty acid binding protein2LKK X
17304OR282L69 X
17305NLRP12 PYD monomer2L6A X
17306NR1C2L6B X
17307HIV-1 Capsid in complex with stapled peptide Inhibitor2L6E X
17309coronavirus stem-loop 22L6I X
17311DHFR.NADPH2LF1 X
17312Tah1 complex with C-terminus of Hsp90 (MEEVD)2L6J X
17314Nonphosphorylated Peptide Recognizing Domain2L6K X
17315C-terminal dsRBD of the Fission Yeast DICER2L6M X
17316T box riboswitch Specifier domain and GA motif2KZL X
17318YP 001092504.12L6N X
17319NP 253742.12L6P X
17320YP 926445.12L6O X
17321W protein of bacteriophage lambda2L6Q X
17322W protein of bacteriophage lambda2L6R X
17323HR6188A2L6U X
17324Mus81-winged helix domain2MC3 X
17327proteorhodopsin2L6X X
17329PROTEIN2L4H X
17330GIP2L70 X
17331GIP in Bicellular media2L71 X
17343NOXO1b2L73 X
17344CHD4-PHD2/H3K9me3 complex2L75 X
17345PROTEIN2L76 X
17346PAP248-2862L77 X
17347PAP248-2862L79 X
17351rG4 substituted Drew Dickerson dodecamer2L7D X
17352Taf14 YEATS domain2L7E X
17353androcam2LMT X
17354high calcium androcam2LMV X
17355meACP2L9F X
17356DGD22L7C X
17358nectin-12L7J X
17359CfR1302L7K X
17360calcium-calmodulin complexes2L7L X
17363DomB2L7N X
17364PTB Domain of TENC1 in complex with the peptide of DLC12LOZ X
17365ASHH2 a CW domain2L7P X
17368MS22MQI X
17370protein BVU 1572(27-141)2L7Q X
17371hs001132L7R X
17374ADF/Cofilin from Trypanosoma brucei2LJ8 X
17377Sans CEN22L7T X
17378PROTEIN2L7U X
173795'-D(*TP*GP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*GP*GP*GP*TP*GP*GP*GP*TP*AP*A)-3', 2-CARBOXYQUINOXALINE2L7V X
17381putative surface protein2L7Y X
17382Raf-1 kinase inhibitor protein2L7W X
17383Crimean Congo Hemorrhagic Fever Virus Cytoplasmic Gn Tail2L7X X
17388USP132L80 X
17389HR5554A2L81 X
17390OR322L82 X
17391protein from Haloferax volcanii2L83 X
17392complex of CBP bromodomain with small molucule J282L84 X
17393CBP bromodomain with small molecule of HBS2L85 X
17394amidated IAPP2L86 X
17395CCR52L87 X
17396Zn bound FCS domain of hPh12L8E X
17397RET oncogene2L88 X
17398A protein from fission yeast2L89 X
17399CBM32L8A X
174015'-R(*CP*CP*GP*CP*UP*GP*CP*GP*G)-3'2L8U 2L8W X
17402LBR Tudor domain2L8D X
17403HlyB-C393ZUA X
17405IPSE/alpha-14AKA X
174065'-R(*GP*UP*GP*AP*AP*GP*CP*CP*CP*GP*U)-3'2L8F X
17407homeodomain2LP0 X
17408HIV TAR RNA2L8H X
17409triazole-linked DNA duplex2L8I X
17412GABARAPL-1 and NBR1-LIR complex2L8J X
17414RecA2L8L X
17415cytochrome P450cam2LQD X
17418Pab PolII intein2LCJ X
17419HTH-TYPE TRANSCRIPTIONAL REPRESSOR CYTR2L8N X
17420Chr1482L8O X
17421C6orf1302L8R X
17422Cidofovir DNA duplex2L8P X
17423Control DNA duplex2L8Q X
17424Integrin 12L8S X
17425island 1 protein gp62L8T X
17429CpcC2L8V X
17430Arenicin-2 dimer2L8X X
17431outer membrane protein RcsF2L8Y X
17432Myristoylated msrA2L90 X
17433Integrin beta32L91 X
17434C-terminal domain of Bv3F2L92 X
17435C-terminal domain of Salmonella H-NS2L93 X
1743645-MER2L94 X
17438LAK160-P72L96 X
17440trans-Resveratrol in complex with the cardiac regulatory protein Troponin C2L98 X
17441LAK160-P7102L99 X
17442LAK160-P122L9A X
17443Solution structure of human ubiquitin conjugating enzyme Rad6b2Y4W X
17447MUP112LB6 X
17448protein YP 546394.12L9D X
17449tRNALys3UUU2L9E X
17450AS1p-TarEc2L9G X
17451M2-12L9J X
17453ccl52L9H X
17456THAP domain of human THAP112LAU X
17458Thymosin-Alpha12L9I X
17475Structural basis of p63a SAM domain mutants involved in AEC syndrome2Y9T X
17477Mouse MFG-E8 C2 Domain2L9L X
17478cIAP1 CARD2L9M X
17479human SBDS2L9N X
17481SeR1472L9P X
17482Hsp122L9Q X
17484HR6470A2L9R X
17485mSin3A PAH2-Pf1 SID1 Complex2L9S X
17488ErbB3tm2L9U X
17489FF domain L24A mutant2L9V X
17490C-terminal domain of Prp242L9W X
17492Thuricin CD2L9X X
17493MoCVNH-LysM module from the rice blast fungus Magnaporthe oryzae protein MGG 033072L9Y X
17494Zinc knuckle in PRDM42L9Z X
17495Thuricin CD2LA0 X
17500papiliocin2LA2 X
17501NP 344798.12LA3 X
17502NUCLEAR AND CYTOPLASMIC POLYADENYLATED RNA-BINDING PUB12LA4 X
17504RNA Duplex-Quadruplex Junction Complex with FMRP RGG peptide2LA5 XX
17508HR6430A2LA6 X
17509YP 557733.12LA7 X
17512primase CTD2LZN X
17515INAD PDZ5 complexed with Kon-tiki peptide2LA8 X
17517Anticodon Stem-loop of Bacillus subtilis tRNATYR2LA9 X
17518Starch Binding Domain 1 of beta/alpha-amylase2LAA X
17519Starch Binding Domain 2 of beta/alpha-amylase2LAB X
17520Unmodified ASL Tyr2LAC X
17521BamC2LAE X
17523Norwalk virus protease2LNC X
17524hr55460a2LAH X
17525ATR132LAI X
17529Nedd4LW3/smad3 complex2LAJ X
17530AHSA1-like protein RHE CH02687 (1-152)2LAK X
17531circular proteins in legumes2LAM X
17532CaBP12LAP X
17533Sex Peptide from Drosophila melanogaster2LAQ X
17534SpaI monomer2LVL X
17535DNA/RNA hybrid2LAR XX
17536Complex of SUMO1 with RanBP2 M-IR2 SIM peptide2LAS X
17537Human minimembrane protein OST42LAT X
17538second WW domain from human YAP in complex with a human Smad1 derived peptide2LAW X
17539first WW domain of human YAP in complex with a human Smad1 doubly-phosphorilated derived peptide2LAX X
17540human Yap in complex with a human Smad1 derived peptide2LAY X
17541human Smurf1 in complex with a phosphorylated human Smad1 derived peptide2LAZ X
17542human Smurf1 in complex with a doubly phosphorylated human Smad1 derived peptide2LB0 X
17543first domain of human Smurf1 in complex with a human Smad1 derived peptide2LB1 X
17544second domain of human Nedd4L in complex with a doubly phosphorylated human Smad3 (res 178-189) derived peptide2LB2 X
17545first domain of human PIN1 in complex with a human Smad3 derived peptide( resi 173-186)2LB3 X
17546Phytochrome2LB5 X
17547Hevein-type Antifungal Peptide with a Unique 10-Cysteine Motif2LB7 X
17551cI-BABP-GCDA complex2LBA X
17553acyl CoA binding protein2LBB X
17554tandem UBA of USP132LBC X
17557human ribosomal protein P1/P2 heterodimer2LBF X
17558CHR/DPC micelle2LBG X
17561Unliganded Bovine Neurophysin2LBH X
17562N2-dG:N2-dG interstrand cross-link induced by trans-4-hydroxynonenal2LBI X
17563glycyl-tRNA anticodon stem-loops2LBJ X
17564Glycyl-tRNA(UCC)1B anticodon stem-loop2LBK X
17565Unmodified Glycyl-tRNA(UCC) anticodon stem-loop2LBL X
175692LBM X
17571MUTANT UNLIGANDED BOVINE NEUROPHYSIN2LBN X
17572i6A37 tyrASL2LBQ X
17573Anticodon Stem-loop (coi6y)2LBR X
17574yeast RNase III dsRBD complex with a non-canonical RNA substrate2LBS XX
17575C domain of Rv08992LBT X
17576gamma-S-WT2M3T X
17577Siderocalin Q832LBV X
17578H/ACA RNP protein Nhp2p-S82W mutant2LBW X
17579H/ACA RNP protein Nhp2p2LBX X
17580Myc G-quadruplex2LBY X
17582gamma-S-G18V2M3U X
17583thurincin H2LBZ X
17584Thp52LMA X
17585Rv0020c Nter2LC0 X
17586Rv0020c FHA2LC1 X
17588AVR3a42LC2 X
17594hs004112LC3 X
17595Nob12LCQ X
17596DewA2LSH X
17598Solution Structure of PilP from Pseudomonas aeruginosa2LC4 X
17599Par-62LC6 X
17600Par-62LC7 X
17601MLV readthrough pseudoknot2LC8 X
17603T4 L99A/G113A/R119P2LC9 X
17604T4 L99A2LCB X
17606RBBP1 chromobarrel domain2LCC X
17607RBBP1 tudor domain2MAM X
17608RLIP76-GAP-GBD2MBG X
17609Hr4436B2LCE X
17610GppNHp-bound H-RasT35S mutant protein2N46 X
17611Rmet 50652N4B X
17612OR382LCH X
17613OR362LCI X
17614UCP22LCK X
17615RfaH carboxyterminal domain2LCL X
17617S4-3 voltage sensor peptide2LCM X
17618WALP19-P10 complex2LCN X
17619WALP192LCO X
17621Solution structure of the EF-hand domain of Human Polycystin 22Y4Q X
17622Solution structure of the closed conformation of human U2AF65 tandem RRM1 and RRM2 domains2YH0 X
17623Model of human U2AF65 tandem RRM1 and RRM2 domains with eight-site uridine binding2YH1 XX
17625Microvirin:mannobiose complex2YHH X
17628Alk12LCR X
17629Nbp2 SH3 and Ste20 peptide2LCS X
17632Syk/Vav complex2LCT X
17633BC28.12LCU X
17634Cytidine Repressor DNA-Binding Domain2LCV X
17635FUS/TLS RRM domain2LCW X
17636Grx domain2LV3 X
17638Ebolavirus Fusion Loop pH 5.52LCY X
17639Ebolavirus Fusion Loop pH 7.02LCZ X
17642htt172LD0 X
17643YtvA Dimer2MWG X
17644htt172LD2 X
17645myosin VI lever arm extension2LD3 X
17646Anamorsin2LD4 X
17651CheA2LD6 X
17653SAP30 and PAH32LD7 X
17655Human Telomeric DNA2LD8 X
17657stapled peptide SP22LDA X
17658stapled peptide SP12LDC X
17659stapled peptide SP62LDD X
17661srtx-i32LDE X
17662srtx-m2LDF X
17667TgMIC4-apple5 monomer2LL4 X
17668ZiaAn sub mutant2LDI X
17669Trp-Cage mini-protein with D-amino acid2LDJ X
17670AaR962LDK X
17671RNA (27-MER)2LDL X
17673TDRD72LDM X
17679JAZ ZF32MKN X
17680CBLB-pY-H-RING2LDR X
17681short chain LaIT 12LDS X
17682RNA (31-MER)2LDT X
17683HR3023C2LDU X
17685Zuo12LWX X
17686L1ORF1p2LDY X
17687PARP-1 BRCT domain2LE0 X
17688TfR85A2LE1 X
17689Uracil-DNA glycosylase inhibitor p562LE2 X
17690carnitine palmitoyltransferase 1A2LE3 X
17691Sox22LE4 X
17693RRM domain of mRNA export adaptor REF2-I bound to HVS ORF57 peptide2YKA X
17694GH84A CBM32-12LS6 X
17697G-quadruplex2LE6 X
17699SOLUTION NMR STRUCTURE OF THE S4S5 LINKER OF HERG POTASSIUM CHANNEL2LE7 X
17701ykud no mutations3ZQD X
17702protein complex for DNA replication2LE8 X
17703RDE-4DC2LTR 2LTS X
17704RAGEC2-S100A13 tetrameric complex2LE9 X
17705SRSF2 RRM2LEA X
17706SRSF22LEB XX
17707SRSF2 RRM/RNA complex2LEC XX
17708N-myc2LED X
17709N-myc2LEE X
17710DsbA and DsbB2LEG X
17711SMN-Gemin2 complex2LEH X
17713Fpr4p(280-392)4BF8 X
17714human prion protein mutant HuPrP(90-231, M129, V210I)2LEJ X
17716Cu(I)Cu(II)-CopK2LEL X
17717NMR Structure of Mouse ApoAI(1-216)2LEM X
17719esophageal cancer-related gene 22LEO X
17720NGlpG2LEP X
17723ChR1452LEQ X
17726conotoxin pc16a2LER X
17727KcsA-Kv1.3 (Closed state)2LES X
17729C-Terminal domain of Ler2LEV XX
17731(E15G)-Crp42LEW X
17732Complex of the C-terminal WRKY domain of AtWRKY4 and a W-box DNA2LEX XX
17733(R7G)-Crp42LEY X
17734PipB22LEZ X
17735sf36362LF0 X
17736AHSA1-like protein CHU 11102LF2 X
17737HopPmal 281 3852LF3 X
17738HIV-1 CA2LF4 X
17739HopAB1Pph1448 220 3202LF6 X
17741ETV6 Q4362LF7 X
17742ETV6 R4582LF8 X
17745PFV RNase H2LSN X
17746(5'S)-8,5'-Cyclo-2'-deoxyguanosine in DNA2LFA X
17747LpR145J2LFC X
17749entity2LFD X
17750N-terminal domain of E3 ligase HECW22LFE X
17751Diiron2LFF X
17752hPRLR-D22LFG X
17753HR3111A dimer2LFH X
17754MucBP2LFI X
17762BS-RNase2LFJ X
17763TdPI2LFK X
17764Abeta2LFM X
17765EAS2LFN X
17767cl-BABP/SS complex2LFO X
17768gp172LFP X
17771CaM-OLFp complex2M0J 2M0K X
17772Solution structure of the RING finger-like domain of Retinoblastoma Binding Protein-6 (RBBP6)3ZTG X
17775chimeric Af1503 HAMP- EnvZ DHp homodimer2LFR X
17776chimeric Af1503 HAMP- EnvZ DHp homodimer; A219F variant2LFS X
17779the intermediate IIIb of the TdPI-short2LFL X
17780Human prion protein with E219K protective polymorphism2LFT X
17783DamX SPOR domain2LFV X
17784PhyRSL-NepR complex2LFW X
17786(5'S)-8,5'-cyclo-2'-deoxyguanosine2LFX X
17787(5'S)-8,5'-cyclo-2'-deoxyguanosine2LFY X
17789(5'S)-8,5'-cyclo-2'-deoxyadenosine2LG0 X
17790(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct2LG2 X
17791(6S,8R,11S) gamma-hydroxy-1,N2-propano-deoxyguanosine adduct2LG3 X
17792aurelin2LG4 X
17797Chicken AvBD2 defensin2LG5 X
17798chicken AvBD2-K31A mutant2LG6 X
17799YP 001302112.12LG7 X
17803InsulinGR2LGB X
17805single polypeptide chain2LGD X
17806YP 001302112.12LGE X
17807Ca2+/CaM L-selectin peptide complex2LGF X
17808Structure of PHD domain of UHRF1 in complex with H3 peptide2LGG X
17809AHSA1-like protein AHA 23582LGH X
17810Ultra-high resolution protein structures using NMR chemical shift tensors2LGI X
17811MsPTH2LGJ X
17812R2 of histone H3 tail by UHRF1 PHD finger2LGK X
17813NMR structure of the UHRF1 PHD domain2LGL X
17814DNA Containing an Aristolactam II-dA Lesion2LGM X
17816Lcn9722LGN X
17818FKBP-type peptidyl-prolyl cis-trans isomerase2LGO X
17821Human C30S/C59S-Cox17 mutant2LGQ X
17822QFMF2LGT X
17824Rbx12LGV X
17825HSJ1a2LGW X
17827k2-n2LGX X
17828HOIL-1 Unl2LGY X
17832HISTONE CHAPERONE RTT1062LH0 X
17833Skint1 IgV2N4I X
17834shPrP, Thiamine2LH8 X
17835TDRD72LH9 X
17838Molecular Level Interaction of the Human Synaptotagmin I C2B domain with Inositol Hexaphosphate2LHA X
17839Ga982LHC X
17840GB982LHD X
17841GB98-T25I,L20A2LHE X
17842OprH2LHF X
17843GB98-T25I2LHG X
17849yCaM 1232LHH X
17850yCaM GS CNA12LHI X
17855NHP12LHJ X
17856CesAB2LHK X
17857S100A1E32Q2M3W X
17858NAB2 404-4832LHN X
17859DNA duplex Containing an Unnatural, Hydrophobic Base Pair2LHO X
17860RNA (37-MER)2LHP X
17862Staphylococcus aureus IsdH linker domain2LHR X
17865ViCin1-D1D22LHT X
17867Myosin Binding Protein-C Motif2LHU X
17868MUC2 Mucin Domain Peptide2LHV X
17869MUC2 Mucin Domain Peptide, SUGAR (3-MER)2LHW X
17870MUC2 Mucin Domain Peptide, SUGAR (2-MER)2LHX X
17871Mucin Glycoprotein Recognition2LHY X
17872MUC2 Mucin Domain Peptide2LHZ X
17873Mucin sequence based on MUC2 Mucin glycoprotein tandem repeat2LI0 X
17874MUC2 Mucin Domain Peptide2LI1 X
17875MUC2 Mucin Domain Peptide2LI2 X
17877RNA (32-MER)2LI4 X
17879Atg8K26P2LI5 X
17880yeast protein2LI6 X
17882CssII2LI7 X
17883Lin28-ZnF domains bound to AGGAGAU of pre-let-7 miRNA2LI8 XX
17884RAT BETA-AMYLOID2LI9 X
17885DNA dodecamer2LIA X
17886holo-acyl carrier protein monomer2M5R X
17887alpha anomeric lesion2LIB X
17888Polyserine Tract of Apis mellifera Vitellogenin, residues 358-3922LIC X
17889NvVg2LID X
17890CCL2 (free)2LIE X
17891kkgf2LIF X
17892CylR2 homodimer2LYJ X
17893CylR2 homodimer2LYK X
17894CylR22LYL X
17895CylR22LYP X
17896CylR22LYQ X
17897CylR22LYR X
17898CylR22LYS X
17899MS12MU3 X
17900BfR3222LIO X
17902CCL2 (+carbohydrate)2LIQ XX
17903Iso-1-cytochrome2LIR X
17904Iso-1-cytochrome2LIT X
17906CurA2LIU X
17907HMG ACPI2LIW X
17908Acidic Scorpion Potassium Channel Toxins2LIX X
17911Mpro-C2LIZ X
17912third SH3 domain of R85FL2LJ0 X
17913SH3C2LJ1 X
17914MerFt2LJ2 X
17915SH32LJ3 X
17918TbPIN12LJ4 X
17919ubiquitin2LJ5 X
17923defensin Lc-def from germinated lentil seeds2LJ7 X
17926CP12 protein2LJ9 X
17927putative thiol-disulfide oxidoreductase2LJA X
17928AM2-BM22LJB X
17929AM2-BM22LJC X
17930monophosphorylated (747pY) beta3 integrin2LJD X
17931biphosphorylated (747pY, 759pY) beta3 integrin2LJE X
17932monophosphorylated (747pY) beta3 integrin2LJF X
17934AIDA1 PTB domain2M38 X
17935GATase subunit (monomer) of GMP Synthetase2LXN X
17936dADAR-dsRBD12LJH X
17937CAP-Gly2M02 X
17939a protein from Haloferax volcanii2LJI X
17941IV-B RNA2LJJ X
17942Complex of hDlg and E62M3M X
17948Hsp122LJL X
17949CssII2LJM X
17952C5 protein monomer2LJP X
17953NMR Structure of protoporphyrin-IX bound murine p22HBP4A1M X
17955(C9S, C14S)-leucocin A2LJQ X
17956MCoTI-V2LJS X
17957BA422LT2 X
17958C9L,C14L-LeuA2LJT X
17961U2U61112LKR X
17962putative oxidoreductase from Ehrlichia chaffeensis2LJU X
17963Rhodostomin G50L mutant2LJV X
17965NsR2642LJW X
17967N-terminal domain of HPV16 E6 oncoprotein2LJX X
17968HPV16 E62LJY X
17969RBM5-ZF12LK0 X
17970RBM5-ZF12LK1 X
17971TGIF12LK2 X
17972U2/U6snRNA2LK3 X
17973onconase FLG variant2LT5 X
17974PAT Pyk2 and Paxillin LD motif2LK4 X
17978MPG12N4O X
17979Zn(II) form of Desulforedoxin2LK5 X
17980G-quadruplexes2LK7 X
17985BST-22LK9 X
17987Ts162LO7 X
17988Mesobuthus {alpha}-scorpion toxins affecting sodium channels2LKB X
17989UUP protein C-terminal domain2LW1 X
17990MYRISTOYLATED ALPHA M2LKJ X
17991Nicotinic Acetylcholine Receptor2LKG X
17992Nicotinic Acetylcholine Receptor2LKH X
17993EC22LQ4 X
17995NE21632LKI X
17997Cd(II) form of Desulforedoxin2LK6 X
18000MRG2LKM X
18001AIP2LKN X
18002Kindlin-22LKO X
18003apo-NmtR2LKP X
18004Structural and functional analysis of the DEAF-1 and BS69 MYND domains4A24 X
18005Molecular system4A4E X
18006Molecular system4A4F X
18007Molecular system4A4G X
18008Molecular system4A4H X
18009lambda 5 22-45 peptide2LKQ X
18010FF11-602LKS X
18011Tb242LVV X
18012N-terminal domain of human TIG32LKT X
18013MS12LKV X
18014Myristoylated Polyproline Type II Helix2LKW X
18015PITX22LKX XX
18016SSGCID2LKY X
18017RRM2LKZ X
18018YP 916642.12LL0 X
18019U1-TRTX-Sp1a2LL1 X
18022Cx43 C-terminal domain bound to tubulin2LL2 X
18023Cyclo-TC1 Trp-cage2LL5 X
18027CaM bound to NOS peptides2LL6 X
18028CaM bound to NOS peptides2LL7 X
18032RPA20222LL8 X
18034UNAC Tetraloops4A4T X
18035UNAC Tetraloops4A4U X
18036UNAC Tetraloops4A4S X
18037ykud imip4A52 X
18039Solution structure ensemble of the two N-terminal apple domains (residues 58-231) of Toxoplasma gondii microneme protein 44A5V X
18040DNA 12LL9 X
18041EDC3-LSm domain4A53 X
18042EDC3 DCP24A54 X
18043Insect Defensin Lucifensin from Lucilia sericata2LLD X
18044eight-stranded (beta/alpha)-barrel2LLE X
18046D62LLF X
18047NP 814968.12LLG X
18048NPM1 C702LLH X
18049RNA-binding subunit of the TRAMP complex2LLI X
18050DNA 12LLJ X
18051myb-like1 domain of hDMP12LLK X
18053hs4992LLL X
18079UNAC Tetraloops4A4R X
18080amyloid precursor protein's transmembrane domain2LLM X
18081apoCuA polypeptide2LLN X
18082Calmodulin N-lobe bound with ER alpha peptide2LLO X
18083THP type 1 alpha 1 collagen fragment (772-786)2LLP X
18084Calmodulin C-lobe bound with ER alpha peptide2LLQ X
18085Alvinellacin2LLR X
18086YjdK2LLZ X
18087S100A1C85M2LLS X
18088Post-translational S-nitrosylation2LLT X
18089Post-translational S-nitrosylation2LLU X
18090DP12LLV X
18091DP22LLW X
18092NeRF12LLX X
18093transmembrane domains of the a4b2 nAChR2LLY X
18094AF4-Af9 fusion2LM0 X
18095FR824D2LM1 X
18096nAChR2LM2 X
18097rhesus SPRY domain2LM3 X
18098YT682A2LM4 X
18099CIB12LM5 X
18102Cysteine Deleted Analog of Tachyplesin-12LM8 X
18107a major allergen from dust mite2LM9 X
18108YadA membrane anchor domain2LME X
18110C-terminal RAGE (ctRAGE)2LMB X
18111T7 transcription factor Gp2-E. coli RNAp jaw domain complex2LMC X
18112HR4660B2LMD X
18113allergenic beta parvalbumin2MBX X
18114human LL-232LMF X
18115C-terminal Domain (537-610) of Human Heat Shock Protein 702LMG X
18118BC0404852LMI X
18119ITK-SH32LMJ X
18121CdnL N-terminal domain2LT4 X
18125avidin2MF6 X
18126Z-L2LBT2LR2 X
1812740-Residue Beta-Amyloid Fibril with Two-Fold Symmetry2LMN X
1812840-Residue Beta-Amyloid Fibril with Two-Fold Symmetry, Negative Stagger2LMO X
1812940-residue Beta-Amyloid Fibril with Three-Fold Symmetry, Positive Stagger2LMP X
18130monomeric Pstrx22LRC X
1813140-residue Beta-Amyloid Fibril with Three-Fold Symmetry, Negative Stagger2LMQ X
18132THERMOSTABLE PROTEIN FROM HYPERTHERMOPHILIC VIRUS SSV-RH4AAI X
18134FIRST SAM DOMAIN OF ODIN2LMR X
18135GLYCOSYLATED HUMAN INTERFERON ALPHA-2A [WITH GALNAC AT THR 106]2LMS X
18141novel conotoxin im23a from Conus imperialis2LMZ X
18142PHD zinc finger2LN0 X
18145OR1352LN3 X
18146coprisin2LN4 X
18151CdnL2LWJ X
18152BA SrtD2LN7 X
18153thermomacin2LN8 X
18156HR6741A2LNA X
18158N-terminal domain (6-74) of human ZBP1 protein2LNB X
18159SB1Jalpha2YOM X
18160SB2Jalpha2YON X
18161OR1342LND X
18162Neurotensin2LNE X
18163Neurotensin2LNF X
18164Neurotensin2LNG X
18165Enterohaemorrhagic E. coli (EHEC)2LNH X
18166HR4403E2LNI X
18167PsbP2LNJ X
18169Ca-bound S100A4 in complex with non-muscle myosin IIA2LNK X
18170human CXCR1 in phospholipid bilayers2LNL X
18171atTic-hip/hop domain (Residue 310-371)2LNM X
1817540-residue D23N beta amyloid fibril2LNQ X
18178AGR2 residues 41-1752LNS X
18179E60A mutant AGR22LNT X
18180HmR112LNU X
18181GspC-HR of typeII secretion system2LNV X
18182Vav2 and Arap32LNW X
18183Vav22LNX X
18184ShB peptide2LNY X
18186Get5 carboxyl domain from S. cerevisiae2LNZ X
18187Get5 carboxyl domain from A. fumigatus2LO0 X
18190BC0081822LO1 X
18191SGF112LO2 X
18192SGF732LO3 X
18193TtCdnLNt2LQK X
18194CarD1-722LT1 X
18195optn 5502LO4 X
18199DNA 12LO5 2LO8 2LOA X
18200RstA C2MLK X
18201HasR N-terminal periplasmic signaling domain2M5J X
18203Mu-contoxin BuIIIB2LO9 X
18205PDZ Domain of CAL and C-terminus of the CFTR2LOB X
18206Conotoxin analogue [D-Ala2]BuIIIB2LOC X
18209DNA molecule G3ATG3ACACAG4ACG32LOD X
18210Conotoxin analogue [D-Ala2]BuIIIB2LOE X
18211Lotus domains 2 and 32LY2 X
18214tstm12732LOJ X
18215HsR502LOK X
18216acyl-carrier protein from Rickettsia prowazekii2LOL X
18217HIGD1A2LOM X
18218HIGD1B2LON X
18219TMEM14A2LOO X
18220TMEM14A2LOP X
18221FAM14B2LOQ X
18222TMEM1412LOR X
18223TMEM14C2LOS X
18224AR552LOT X
18225AR552LOU X
18226AR552LOV X
18227AR552LOW X
18228TpbA monomer2M3V X
18229complex between the PH domain of the Tfb1 subunit from TFIIH and Rad22LOX X
18230S100A1 dimer2LP2 X
18231S100A1 homodimer2LP3 X
18234P1-CheY/P2 complex2LP4 X
18237gp41-M-MAT2LP7 X
18238APOPTOSIS ACTIVATING PHOTOSWITCHABLE BAK PEPTIDE BOUND to BCL-XL2LP8 X
18239RNA (5'-R(*GP*AP*GP*GP*AP*CP*AP*UP*AP*GP*AP*UP*CP*UP*UP*C)-3')2LP9 X
18240Mutant of the sub-genomic promoter from Brome Mosaic Virus2LPA X
18242PYNOD PYD2M5V X
18244complex of the central activation doamin of Gcn4 bound to the mediator co-activator domain 1 of Gal11/med152LPB X
18250Bcl-XL2LPC X
18255MbtH-like protein2LPD X
18256monomeric phospholamban (C36A, C41F, C46A)2LPF X
18261A72R2LPI X
18262Major ampullate spidroin 12LPJ X
18263RPA20222LPK X
18269N-terminal domain of human CDNF2LPN X
18276PrgI needle2MEX X
18277KmAtg102LPU X
18278FKBP12 from Aedes aegypti2LPV X
18279human CEB25 minisatellite G-quadruplex2LPW X
18281Strawberry2LPX X
18282M-PMV MYRISTOYLATED MATRIX PROTEIN2LPY X
18283YmgD dimer2LRV X
18284antifreeze peptide 1m2LQ0 X
18286antifreeze peptide 32LQ1 X
18289antifreeze peptide 4m2LQ2 X
18290SnR2122LQ3 X
18292RBM392LQ5 X
18296BRD1 PHD2 finger2LQ6 X
18297Uba32LQ7 X
18298NusG2LQ8 X
18299K60A mutant of Atox12LQ9 X
18300Solution NMR structure of asteropusin A from marine sponge Asteropus sp.2LQA X
18301MBD22LQB X
18302calcium-bound CaM N-terminal domain in a complex2LQC X
18313A domain of talin2LQG X
18314FOXO3a2LQH X
18315FOXO3a2LQI X
18316C-terminal domain of the MgtC protein2LQJ X
18318CHCH52LQL X
18320PhoRadA intein2LQM X
18321CRKL2LQN X
18322reduced Mrx12LQO X
18323calcium-bound CaM C-terminal domain in a complex2LQP X
18325oxidized Mrx12LQQ X
18328CHCHD72LQT X
18329DBPA2LQU X
18332Escherichia coli Porins2LQV X
18333phosphorylated CRKL2LQW X
18334trypsin inhibitor BWI-2c2LQX X
18335gH625-6442LQY X
18336RNA (27-MER)2LQZ X
18337OR1362LR0 X
18338PPc2LUW X
18340Bax+vMIA2LR1 X
18341Sgt2 NT homodimer4ASV X
18342Get5 UBL domain4ASW X
18345anti-fungal defensin DEF4 (MTR 8g070770)2LR3 X
18346NP 390037.1 from Bacillus subtilis2LR4 X
18347micasin2LR5 X
18349RF2209A2LR6 X
18350cathelicidin-PY2LR7 X
18351MS34AOG X
18352HR8150A2LR8 X
18354conotoxin TIA2LR9 X
18355Rv0603-SSD2LRA X
18356ADF like UNC-60A Protein2MP4 X
18357Acanthaporin2LRD X
18358dimeric Acanthaporin2LRE X
18363Scylla Serrata anti lipopolysaccharide Factor-24 (SsALF-24) peptide2MDL X
18364GS13500A assembly2LRG X
18372OR1372LRH X
18374AIRE-PHD22LRI X
18375staphyloxanthin protein2LRJ X
18378Liraglutide4APD X
18379IIA(chb)-HPr complex2LRK 2LRL X
18387thiol:disulfide interchange protein2LRN X
18388CtCBM112LRO X
18389CtCBM112LRP X
18390Fr822A2LRQ X
18391R3H domain from human Smubp-2 in complex with 2'-deoxyguanosine-5'-monophosphate2LRR X
18393dsRBD2LRS X
18394uncharacterized thioredoxin-like protein BVU 14322LRT X
18398WNK1 Autoinhibitory Domain2LRU X
18399ubiqutin-like protein from Trypanosoma bucei2LRW X
18400CTD-StpA2LRX X
18404Target Recognition Domain of Zoocin A2LS0 X
18405Sviceucin2LS1 X
18408first transmembrane domain from human copper transport 12LS2 X
18409second transmembrane domain from human copper transport 12LS3 X
18410third transmembrane domain from the human copper transport 12LS4 X
18411putative protein disulfide isomerase2LS5 X
18412phosphoprotein enriched in astrocytes 15A2LS7 X
18415human C-type lectin domain family 4 member D2LS8 X
18416ubiquitin homology of mouse BAG-12LWP 2M8S X
18418pleurocidin2LS9 X
18420magainin2LSA X
18425S100A11 dimer2LUC X
18426human prion protein2LSB X
184272'F-ANA and ANA self-complementary duplex2LSC X
18429OR1882LSE X
18430Duplex DNA Containing (5 S) 5 ,8-Cyclo-2 -Deoxyadenosine2LSF X
18431mouse Rev1 C-terminal domain2LSG X
18432Rev12LSI X
18433mouse Rev1 CTD in complex with the RIR of Pol Kappa2LSJ X
18434C-terminal domain of human REV1 in complex with DNA-polymerase H (eta)2LSK X
18435C-terminal domain of Tetrahymena telomerase protein p652LSL X
18437gpFI C-terminal domain2LSM X
18438HR7057A2LSO X
18439BRD4 second bromodomain with NF-kB-K310ac peptide2LSP X
18440Analog of the fragment 197-221 of 1- adrenoreceptor2LSQ X
18441harmonin2LSR X
18442R. rickettsii cold shock-like protein2LSS X
18443thioredoxin2LST X
18445yeast Tah12LSU X
18447yeast Tah1 in complex with the Hsp90 C-terminal tail2LSV X
18449SBM2LSW X
18452Synthetic cyclic oligonucleotide2LSX XX
1845311 mer oligonucleotide-B2LSZ X
1845411 mer oligonucleotide-B2LT0 X
18455REV1-CT2LSY X
18459N0 domain of Neisseria meningitidis Pilus assembly protein PilQ4AR0 X
18462Kaiso2LT7 XX
18463Eurocin2LT8 X
18464NCX32LT9 X
18465OR1572LTA X
18466Wild-type FAS1-42LTB X
18467FAS1-4 R555W2LTC X
18468PaT4152LTE X
18469YdbC2LTD X
18471PWWP domain2NAS X
18474pwwp domain of TFIIS2-12M1H X
18475P2 gpX2LTF X
18478P75/LEDGF PWWP Domain2M16 X
18480major ampullate spidroin 1 N-terminal domain2LTH X
18481ASTEXIN12LTI X
18484G52LTJ X
18485Tb 1-C-Grx1 monomer2LTK X
18487YR313A2LTL X
18489HR2876B2LTM X
18490TDRD3 complex2LTO X
18492SANT2 domain of NCoR22LTP X
18493DsbB C41S2LTQ X
18496YdbC:dT19G1 complex2LTT XX
18497autoinhibitory domain of human AMP-activated protein kinase catalytic subunit2LTU X
18498YAP WW2 in complex with a Smad7 derived peptide2LTV X
18499YAP WW1 in complex with a Smad7 derived peptide2LTW X
18500Smurf1 WW2 domain in complex with a Smad7 derived peptide2LTX X
18501NEDD4L WW2 domain in complex with a Smad7 derived peptide2LTY X
18502Smurf2 WW3 domain in complex with a Smad7 derived peptide2LTZ X
18503RNA (49-MER)2LU0 X
18504pfsub22LU1 X
18506Tg Micronemal Protein 52LU2 X
18507beta2 carbohydrate module of AMP-activated protein kinase2LU3 X
18508beta2 carbohydrate module of AMP-activated protein kinase bound to glucosyl-cyclodextrin2LU4 X
18509Cu(I),Zn(II) superoxide dismutase2LU5 X
18510m-conotoxin2LU6 X
18511HR8578D2LU7 X
18513recombinant tamapin2LU9 X
18514MSL22LUA X
18515RNA (37-MER)2LUB X
18517EDK-delta-Bd372LUD X
18518LC3B OPTN-LIR Ptot complex structure2LUE X
18519Retro Trp-cage peptide2LUF X
18520S72-S107 peptide of 18.5kDa murine MBP2LUG X
18521Vta1-Vps60 complex2LUH X
18522PICK1 PDZ domain fused to the C10 DAT ligand2LUI X
18523HSP12 SDS4AXP X
18524DNA OUH2LUJ X
18526HR3504C2LUL X
18531GB32LUM X
18532RNA Aptamer for B. anthracis Ribosomal Protein S82LUN X
18533mptpa2LUO X
18534Ribonuclease III in complex with RNA (32-MER)2LUP XX
18535Ribonuclease III2LUQ X
18536KB1[GHRW; 23-28]2LUR X
18539protein 162LUS X
18540midkine-a2LUT X
18541midkine-b2LUU X
18542Cytosolic Tails of aXb2 Integrin2LUV X
18545C85M S100A1 dimer2LUX X
18546tandem zinc finger domain of Stc12LUY X
18547MiR122LUZ X
18548Fam96a2M5H X
18549Helix-35 Stem-loop from E. coli 23S rRNA2LV0 X
18550V210I2LV1 X
18551C2H2-type Zinc-fingers 4 and 5 from human Insulinoma-associated protein 1 (fragment 424-497)2LV2 X
18553ZirS C-terminal Domain2LV4 X
18555PA10752LV5 X
18556complex between Ca-Calmodulin and skeletal muscle myosin light chain kinase2LV6 X
18557Ca2+-bound CaBP7 N-terminal doman2LV7 X
18558OR162LV8 X
18559MLL52LV9 X
18560hs356 22 1322LVA X
18561OR2502LVB X
18562VvMARTX2N9W X
18563HR8578K2LVC X
18565MLD PMT2N9V X
18566TL-domain2M5S X
18567S114A mutant of UVI31+2N8Q X
18568NS4B2LVG X
18570zinc finger AFV1p06 protein2LVH X
18571apo-Phl p 72LVI X
18572hemi-Mg-bound Phl p 72LVJ X
18573Ca-bound Phl p 72LVK X
18579Methylated Histone Complex2LVM X
18581gp78 CUE domain2LVN X
18582gp78CUE bound to ubiquitin2LVO X
18583gp78CUE/K48-Ub2 complex2LVP X
18584gp78CUE/K48-Ub2 complex2LVQ X
18586MS12LVR 2LVT 2LVU X
18587MHV nsp3a momoner2M0A X
18589Cbp22LVS X
18590S. aureus pepA1 NMR structure4B19 X
18591ilvN2LVW X
18592MRH domain2LVX X
18593RNA Duplex Containing a 2'-O-Pivaloyloxymethyl Modification2LVY X
18595ASR5UK6 X
18596Eosinophil Cationic Protein2LVZ XX
18599FH11-124B2S X
18600S674B2U X
18602soluble domain of MmpS42LW3 X
18605HR8682B2LW4 X
18606anti-CRISPR protein Acr30-352LW5 X
18607Avrpiz-t2LW6 X
18612HisRS2LW7 X
18613Eph receptor2LW8 X
18614Myo10 anti-CC2LW9 X
18617G8A mutant of the influenza hemagglutinin fusion peptide2LWA X
18618BAD-1 repeat loop2LWB X
18619Menk in DMPC SUV2LWC X
18621La-type RNA-binding domain2M5W X
18622second CARD of human RIG-I2LWD X
18623mutant (T170E) second CARD of human RIG-I2LWE X
18624N-terminal domain of a plant Grx2LWF X
18625Self-Complementary 10 mer DNA Oligonucleotide 5'-GGATATATCC-3'2LWG X
18626Self-Complementary 10 mer DNA Duplex 5'-GGATATATCC-3' in Complex with Netropsin2LWH X
18627VILIP-3 monomer5T7C X
18628MS12MVZ X
18629H-RasT35S mutant protein in complex with Kobe26012LWI X
18632MS16I9F X
18633small molecule-influenza RNA complex2LWK X
18634human beta-defensins 1 and 62LWL X
18636MS12N0M X
18637rNa-FAR-14UET X
1863811 mer oligonucleotide-B2LWM X
18639Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWN X
18640Duplex DNA Containing a b-Carba-Fapy-dG Lesion2LWO X
18641PawS derived peptide 11 (PDP-11)2LWQ X
18642Protein2LWR X
18643PawS Derived Peptide 4 (PDP-4)2LWS X
18644PawS Derived Peptide 5 (PDP-5)2LWT X
18645PawS Derived Peptide 7 (PDP-7)2LWU X
18648APPTM V44M dimer2LZ4 X
18649APPTM dimer2LZ3 X
18650RelA-TAD/CBP-TAZ1 complex2LWW X
18651MxiH needle2MME X
18653Bacterial Intein-Like domain from Clostridium thermocellum2LWY X
18654Single-chain Insulin2LWZ X
18655Transmembrane Arced Helix (ArcH)2LX0 X
18656Internal Loop 5'GAGU/3'UGAG2LX1 X
18657nfeAFP112LX2 2LX3 X
18658peptide a2N(1-17) from Mus musculus V-ATPase2LX4 X
18659peptide epsilon(103-120)2LX5 X
18661CSGI2LX6 X
18662SH3 domain of GAS72LX7 X
18663The third member of the eIF4E family represses gene expression via a novel mode of recognition of the methyl-7 guanosine cap mo4B6V X
18667Solution structure of eIF4E3 in complex with m7GDP4B6U X
18668FeoA2LX9 X
18669Get52LXA X
18670Sgt2 homodimerization domain2LXB X
18671complex between the Sgt2 homodimerization domain and the Get5 UBL domain2LXC X
18672S4WYILD2LXE X
18673potential acylphosphatase from Giardia lamblia2LXF X
18677RING domain in ubiquitin ligase gp782LXH X
18678RRM1-RBM102LXI X
18679LmCsp dT72LXJ X
18680LmCsp2LXK X
18681LIP5(MIT)22LXL X
18682LIP5-CHMP52LXM X
18684Chimeric Peptide of HBD2 and HBD32LXO X
18688gp78 RING bound to Ube2g2:G2BR2LXP X
18690MOMERIC PIL-E G-QUADRUPLEX DNA2LXQ X
18692HP12642LXR X
18694KIX domain complex2LXS X
18695KIX domain complex (3)2LXT X
18698HR8614A2LXU X
18699DIMERIC PIL-E G-QUADRUPLEX DNA2LXV X
18700XIAP(RING)-binding domain of XAF12LXW X
18702RNA BINDING PROTEIN Solution structure of the third KH domain of KSRP in complex with the G-rich target sequence.4B8T XX
187032-mercaptophenol-alpha3C2LXY X
18705Antimicrobial Peptide Human Defensin 52LXZ X
18706influenza A virus S31N mutant (19-49) in presence of drug M2WJ3322LY0 X
18707TamA POTRA domain I2LY3 X
18709HMG-box/p532LY4 X
18710recombinant brazzein2LY6 X
18711CH3CS4BA8 X
18712b-flap domain of RNA polymerase (B. subtilis)2LY7 X
18713sC42LY8 X
18714HR7907F2LY9 X
18715MA2LYA X
18716HIV-1 myr(-) matrix protein in complex with 1,2-dioctanoyl-sn-phosphatidyl-L-serine2LYB X
18717Ska1-MTBD2LYC X
18720Dm DCP1 EVH1 domain in complex with the XRN1 DBM peptide2LYD X
18722BTD-22LYE X
18723RTD-12LYF X
18724G-quadruplex DNA2LYG X
18725Faap242LYH X
18726AcSp1-RP2LYI X
18728UP12LYV X
18729MS24B2V X
18732NP 390345.12LYX X
18733NB7890A2LYY X
18734ZP 02034617.12LZ0 X
18735HR3520O2LZ1 X
18736Conotoxin TxIB2LZ5 X
18737complex of ubiquitin and CD2-associated protein2LZ6 X
18749Ligase 10C2LZE X
18753biofilm matrix promoter AbbA from B. subtilis2LZF X
18755Mdm2 (6-125) with Pip-12LZG X
18757theta-defensin HTD-2 (retrocyclin 2)2LZI X
18758First Catalytic Cysteine Half-domain2LZJ X
18762N2-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene2LZK X
18763FGFR3tm2LZL X
18764Phf19 links methylated lysine 36 of histone H3 to regulation of Polycomb activity4BD3 X
18766PI-AnmTX Ugr 9a-12LZO X
18768NS2(2-32) GBVB protein2LZP X
18769NS2(32-57) GBVB protein2LZQ X
18770TatA T22P2LZR X
18771TatA oligomer2LZS X
18776Hordeum vulgare glycine rich- RNA binding protein 12MPU X
18778LIMD22LZU X
18780DNA duplex containing mispair-aligned O4U-heptylene-O4U interstrand cross-link2LZV X
18781DNA2LZW X
18782Solution structure of the QUA1 dimerization domain of pXqua, the Xenopus ortholog of Quaking.2YMJ X
18783ASTEROPSIN B FROM MARINE SPONGE ASTEROPUS2LZX X
18784ABU8-32LZY X
18787F15L polypeptide2LZZ X
18788staphylococcal nuclease E43S mutant2M00 X
18789Kunitz-type neurotoxin LmKKT-1a2M01 X
18792BCL-xL2M03 X
18793BCL-xL in complex with PUMA BH3 peptide2M04 X
18794module 2 from the E1 domain of C. elegans APL-12M05 X
18796OmpX in phopspholipid nanodiscs2M06 X
18797OmpX in DPC micelles2M07 X
18801NmPin2M08 X
18802SF1N2M09 X
18804ErbB1 (EGFR, HER1)2M0B X
18805HR4490C2M0C X
18806Miz582M0D 2M0E 2M0F X
18808Nterminal domain of splicing factor 12M0G X
18809SP-B C-terminal residues 59-802M0H X
18811Spidroin2M0M X
18812DUF33492M0N X
18813human PHF1 in complex with H3K36me32M0O X
18816CR102M0P X
18817KCNE22M0Q X
18818human S100A142M0R X
18822trans-membrane domain of the NS2A2M0S X
18823PpdD6GMS X
18824extended PDZ1 domain from NHERF12M0T X
18825C-terminal CFTR peptide and extended PDZ1 domain from NHERF12M0U X
18826C-terminal CFTR peptide and extended PDZ2 domain from NHERF12M0V X
18830ALPS-23 peptide in SDS micelles2M0W X
18831U14Ub12M0X X
18832SH3 domain of DOCK1802M0Y X
18833PDZ2M0Z X
18834PDZ2M10 X
18835dodecamer duplex2M11 X
18838ID3 stem loop of domain 1 in the ai5gamma group II intron2M12 X
18840CPEB1-ZZ G-P-504-5662M13 X
18841Antitoxin PaaA23ZBE X
18842complex between the PH domain of the Tfb1 subunit from TFIIH and Rad42M14 X
18843FUN-EGF32M74 X
18844UBLCP12M17 X
18845SUP-124CH0 X
18846SUP-124CIO XX
18847stacked G-quadruplex formed by human TERRA sequence2M18 X
18849BfmrC2NAZ X
18850Haloferax volcanii HVO 2177 protein2M19 X
18852HIV-1 Rev ARM peptide (residues T34-R50)2M1A X
18853LpoA n-ter2MHK X
18856GtYybT PAS Homodimer2M1C X
18858Biosynthetic engineered B28K-B29P human insulin monomer2M1D X
18859Biosynthetic engineered B28K-B29P human insulin monomer2M1E X
18861Antiamoebin I2M1F X
18862Parallel human telomeric quadruplex containing 2'F-ANA substitutions2M1G X
18863MS13ZD0 X
18864CsPinA2M1I X
18865OvDpl(1-30)2M1J X
18868Human S100A6 (C3S) with V domain of Receptor for Advanced Glycation End products (RAGE)2M1K X
18869HR8910C2M1L X
18870dimerization domain of Aux/IAA transcription factor Ps-IAA4 from pea (Pisum sativum)2M1M X
18871chaperone in type III secretion system2M1N X
18872ID3 stem2M1O X
18874ING4 PHD mutant N214D2M1R X
18875[Aba5,14]BTD-2, cyclic peptide2M1P X
18876Complex of MDM2(3-109) and p73 TAD(10-25)2MPS X
18877CaBP4 polypeptide2M29 X
18878Solution structure of the Hs. PSIP1 PWWP domain3ZEH X
18879SP-B C-terminal (residues 59-80) peptide2M1T X
18880MlcB2M1U X
18881d3'-hairpin from the Sc.ai5gamma group II intron including the EBS1:dIBS1 RNA:DNA hybrid2M1V XX
18882TICAM-2 TIR domain2M1W X
18883TICAM-1 TIR domain2M1X X
18887hypothetical protein lmo04272M1Z X
18888EGFR transmembrane - juxtamembrane (TM-JM) segment2M20 X
18891Tetrahymena telomerase RNA stem IV terminal loop2M21 X
18892helix II template boundary element from Tetrahymena telomerase RNA2M22 X
18893d3'-hairpin of the group II intron Sc.ai5gamma including EBS1 bound to IBS12M23 X
18894d3'-hairpin including the exon binding site 1 (EBS1) of the group II intron Sc.ai5gamma2M24 X
18896BI-FUNCTIONAL LYSOZYME-PROTEASE INHIBITOR2N17 X
18897NMR structure of the glycosylated conotoxin CcTx from Conus consors4B1Q XX
18900NMR structure of the catalytic domain from E. faecium L,D-transpeptidase3ZG4 X
18901C-terminal domain of the protein HCFC12M26 X
18902major G-quadruplex2M27 X
18904two domain PPIase SlpA from Escherichia coli2M2A X
18905RRM2 domain of the protein RBM10 from homo sapiens2M2B X
18906CHD42N5N X
18907Duplex DNA2M2C X
18908Human programmed cell death 1 receptor2M2D X
18909hs005072M2E X
18910NMR solution structure of the AVR3a11 from Phytophthora Capsici3ZGK X
18911NMR structure of the catalytic domain from E. faecium L,D-transpeptidase acylated by ertapenem3ZGP X
18912ADAM172M2F X
18913[Aba3,16]BTD-22M2G X
18914[Aba3,7,12,16]BTD-22M2H X
18916BRCT domain of yeast REV12M2I X
18917tstm13952M2J X
18919Full-length cytochrome b5 with heme B2M33 X
18920Entamoeba histolytica HP1 chromodomain2M2L X
18921[L-HisB24] insulin analogue at pH 1.92M2M X
18923[L-HisB24] insulin analogue at pH 8.02M2N X
18924chain A2M2O X
18925chain A2M2P X
18926MCh-12M2Q X
18931[Aba5,7,12,14]BTD-22M2S X
18933ASFV Pol X2M2T X
18934Binary complex of African Swine Fever Virus Pol X with MgdGTP2M2U X
18935African Swine Fever Virus Pol X in the ternary complex with MgdGTP and DNA2M2V 2M2W XX
18937[Aba3,5,7,12,14,16]BTD-22M2X X
18938BTD-2[3,4]2M2Y X
18939C-terminal AbrB2MJG X
18942alpha-1 integrin I-domain in complex with GLOGEN triple helical peptide2M32 X
18943N-terminal domain of pneumococcal PhtD protein with bound Zn(II)3ZFJ X
18944Gbx12M34 X
18945k-Ssm1a2M35 X
18946As1a2M36 X
18948LASSO PEPTIDE ASTEXIN-1(19)2M37 X
189503',5'-LINKED 2'-O-(2-METHOXYETHYL)-RNA DUPLEX2M39 X
18951MYB-like DNA binding domain of KNL-2 from C. Elegans2M3A X
18952Phospholamban2M3B X
18953gammaM-crystallin2M3C X
18954GUCT2M3D X
18955STRUCTURE OF NAB2P TANDEM ZINC FINGER 123ZJ1 X
18956STRUCTURE OF NAB2P TANDEM ZINC FINGER 343ZJ2 X
18958Integrin L Transmembrane Domain2M3E X
18959Rsa1p238-2592M3F X
18963Dido PHD2M3H X
18964Novel Alpha4/6-Conotoxin TxIC2M3I X
18965Marine Sponge-Derived Asteropsin E2M3J X
18966ComP2M3K X
18967E62M3L X
18970peptide2M3N X
18971WW3*-aENaC PY peptide complex2M3O X
18972SOLUTION STRUCTURE OF THE SOMATOSTATIN SST3 RECEPTOR ANTAGONIST TAU-CONOTOXIN CnVA3ZKT X
18973DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion2M3P X
18974HELIX 692MER X
18975Unmodified Helix 692MEQ X
18976Ca-containing EF-hand protein2M3S X
18978Ph1500: a homohexameric protein centered on a 12-bladed beta-propeller2M3X X
18979DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer2M3Y X
18980NC inhibitor 3 complex2M3Z X
18981DNA duplex containing a cluster of mutagenic 8-oxo-guanine and abasic site lesion2M40 X
18982CIC polypeptid2M41 X
18984DNA containing a cluster of 8-oxo-guanine and abasic site lesion : beta anomer2M43 X
18985DNA 12M44 X
18986C-terminus of the minichromosome maintenance protein MCM2M45 X
18987SACOL08762M46 X
18989CgR1602M47 X
18990protein2M48 X
18995Human S100B and Basic Fibroblast Growth Factor (FGF2) Interaction2M49 X
18998Allatide O4 conformation 22MI9 X
18999allatide conf12MIA X
19000VV2 01752M4E X
19001OspE2M4F X
19002Core Domain (11-85) of the Murine Norovirus VPg protein2M4G X
19003Core Domain (10-76) of the Feline Calicivirus VPg protein2M4H X
19007MinC N-terminal monomer2M4I X
1900940-residue beta-amyloid fibril2M4J X
19012hypothetical protein BT 08462M4L X
19013RRM domain of the hypothetical protein2M4M X
19014putative Ras interaction domain of AFD-1, isoform a from Caenorhabditis elegans2M4N X
19017Bulges in G-quadruplexes2M4P X
19018E. coli ribosomela decoding site with apramycin2M4Q X
19023RNA polymerase binding protein A (RbpA)2M4V X
19024single G-bulge in a conserved regulatory region of the HEV genome2M4W X
19026HWTX-IV2M4X X
19027rubredoxin type protein from Mycobacterium ulcerans2M4Y X
19028MBF1-C2MEZ X
19030Huwentoxin-IV2M4Z X
19032Huwentoxin-IV2M50 X
19033SH3 domain of human RAS GAP 12M51 X
19034third RNA Recognition Motif (RRM) of U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 22M52 X
19035G-rich VEGF aptamer with LNA modifications2M53 X
19036Calmodulin/a-syn peptide complex2M55 X
19038complex of cytochrome P450cam and its electron donor putidaredoxin2M56 X
19039domain 5 from Azotobacter vinelandii Intron 52M57 X
190402'-5' AG1 lariat forming ribozyme2M58 X
19041VEGFR2tm2M59 X
19042Frataxin like monomer2MPE X
19043Protein A binding by an engineered Affibody molecule2M5A X
19045BID-BAK complex2M5B X
19047BcII2M5C X
19048BcII2M5D X
19049Solution structure of chicken Engrailed 2 homeodomain3ZOB X
19050Calmodulin IQ motif complex2M5E X
19052Ebolavirus Fusion Loop L529A/I544A2M5F X
19053FimA wt2M5G X
19054human apoptotic protein tBid2M5I X
19056IsdB N12MOQ X
19058doublet cross-beta amyloid fibril2M5K X
19059ns5a3082M5L X
19060triplet cross-beta amyloid fibril2M5M X
19062cross-beta protofilament2M5N X
19066Solution structure of the FimH adhesin carbohydrate-binding domain3ZPD X
19067Solution structure of latherin3ZPM X
19068HR2876C2M5O X
19070GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE2M5P X
19071GLUCAGON AIB2,16 LYS13-GAMMAGLU-GAMMAGLU-C16 AMIDE2M5Q X
19077USP28 monomer2MUU X
19078fibrillin e2cb15MS9 X
190792A proteinase from a common cold agent, human rhinovirus RV-C02, strain W122M5T X
19081P4 CPEB32M5U X
19084mengovirus2MMH X
19085SPI-2 inhibitor2M5X X
19086Solution structure of human ribosomal protein P1.P2 heterodimer4BEH X
19087C-terminal RV04312M5Y X
19094Enterocin 7A2M5Z X
19095SsoSSB2MNA X
19098Nop62MZJ X
19101Enterocin 7B2M60 X
19102M-2 Branch Mini-M Conotoxins2M61 X
19103ar12482M62 X
19106TICAM-12M63 X
19107Phl p 5a2M64 X
19108human restriction factor APOBEC3A2M65 X
19111USP252MUX X
19115MerF2MOZ X
19117Domain 11:IGF2 complex2M68 X
19124antimicrobial peptide Tk-Amp-X22M6A X
19126GlyR2M6B 2M6I X
19128cIn9362M6C X
19129tIn936W2M6D X
19130cIn936M2M6E X
19131tIn936M2M6F X
19132ctLO959W2M6G X
19133ttLO959M2M6H X
19142vertebrate toxin from the badge huntsman spider2M6J X
19143FepB2M6K X
19144CAP mutant (T127L and S128I) in the apo state4BH9 X
19145A structural model of CAP mutant (T127L and S128I) in cGMP-bound state4BHP X
19146RING domain of E3 ubiquitin ligase Doa102M6M X
19147APC/C CDH1-EMI1: multimodal mechanism of E3 ligase shutdown2M6N X
19148actinobacterial transcription factor RbpA2M6O X
19149actinobacterial transcription factor RbpA2M6P X
19151apo YqcA2M6R X
19152holo YqcA2M6S X
19153IGF2R2M6T X
19155CbpAN from Streptococcus pneumoniae2M6U X
19157Atomic-resolution structure of a quadruplet cross-beta amyloid fibril3ZPK X
19158DNA (5'-D(*GP*GP*GP*TP*TP*GP*GP*GP*TP*TP*TP*TP*GP*GP*GP*TP*GP*GP*G)-3')2M6V X
19159d(GGGGTTGGGGTTTTGGGGAAGGGG) quadruplex2M6W X
19162p7 channel of Hepatitis C virus, genotype 5a2M6X X
19163J-domain of human DnaJA12M6Y X
19164cerebral dopamine neurotrophic factor (CDNF)4BIT X
19167CsPABP12M70 X
19168C-terminal domain of translation initiation factor IF-32M71 X
19169PG 21752M72 X
19170calmodulin-binding domain of plant calcium-ATPase ACA82M73 X
19174Regulatory Domain of Human Brain Carnitine Palmitoyltransferase 12M76 X
19175[Asp2]RTD-12M77 X
19176[Asp11]RTD-12M78 X
19177[Asp2,11]RTD-12M79 X
19178MS12M7A X
19179mol12M7B X
19180Trp-cage Circular Permutant2M7C X
19183Trp-cage 16b P12W: a Hyperstable Miniprotein2M7D X
19184calmodulin-binding domain of plant calcium-ATPase ACA22M7E X
19185PilA2M7G X
19187Methanothermobacter thermautotrophicus MCM C-terminus2MA3 X
19190LptD2M7I X
19192beta-Hairpin Peptidomimetic Antibiotics2M7J X
19193(Y81F)-EhCaBP12M7K X
19195alfa-actinin from parasite Entamoeba histolytica2M7L X
19196(Y81F)-EhCaBP12M7M X
19197C-terminal structure of (Y81F)-EhCaBP12M7N X
19198SP18156A2M7O X
19200LDLa2M7P X
19201TAX1BP1 UBZ1+22M7Q X
19202CONANTOKIN BK-B2M7R X
19203RRM2 of Homo sapiens splicing factor, arginine/serine-rich 12M7S X