Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30552
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Dickerhoff, J.; Onel, B.; Chen, L.; Chen, Y.; Yang, D.. "Solution Structure of a MYC Promoter G-Quadruplex with 1:6:1 Loop Length
" Acs Omega 4, 2533-2539 (2019).
Assembly members:
entity_1, polymer, 27 residues, 8563.501 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTGGGGAGGGTTTTAAGGGT
GGGGAAT
| Data type | Count |
| 13C chemical shifts | 32 |
| 1H chemical shifts | 260 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
Entity 1, entity_1 27 residues - 8563.501 Da.
| 1 | DT | DT | DG | DG | DG | DG | DA | DG | DG | DG | ||||
| 2 | DT | DT | DT | DT | DA | DA | DG | DG | DG | DT | ||||
| 3 | DG | DG | DG | DG | DA | DA | DT |
sample_1: DNA (27-MER) 1.5 mM; potassium phosphate 25 mM; potassium chloride 75 mM
sample_conditions_1: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 278 K
sample_conditions_3: ionic strength: 100 mM; pH: 7; pressure: 1 atm; temperature: 313 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_3 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
AMBER v16, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, and Kollman - refinement
X-PLOR NIH v2.48, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation
CcpNMR, CCPN - chemical shift assignment, peak picking
TOPSPIN v3.5, Bruker Biospin - processing