Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5655
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sashital, D.; Allmann, A.; Van Doren, S.; Butcher, S.. "Structural basis for a lethal mutation in U6 RNA" Biochemistry 42, 1470-1477 (2003).
PubMed: 12578359
Assembly members:
U6 ISL RNA, polymer, 24 residues, Formula weight is not available
Natural source: Common Name: Baker's yeast Taxonomy ID: 4932 Superkingdom: Eukaryota Kingdom: Fungi Genus/species: Saccharomyces cerevisiae
Experimental source: Production method: recombinant technology
Entity Sequences (FASTA):
U6 ISL RNA: GGUUCCCCUGCAUAAGGAGG
AACC
| Data type | Count |
| 13C chemical shifts | 138 |
| 15N chemical shifts | 15 |
| 1H chemical shifts | 203 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | U80G U6 ISL RNA | 1 |
Entity 1, U80G U6 ISL RNA 24 residues - Formula weight is not available
| 1 | G | G | U | U | C | C | C | C | U | G | ||||
| 2 | C | A | U | A | A | G | G | A | G | G | ||||
| 3 | A | A | C | C |
sample_1: U6 ISL RNA, [U-13C; U-15N], 1.5 mM
cond_1: pH: 6.5; temperature: 303 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| not available | sample_1 | not available | cond_1 |
CNS v1.1 -