Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR18036
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Zhao, Qin; Huang, Hung-Chung; Nagaswamy, Uma; Xia, Youlin; Gao, Xiaolian; Fox, George. "UNAC tetraloops: to what extent do they mimic GNRA tetraloops?" Biopolymers 97, 617-628 (2012).
PubMed: 22605553
Assembly members:
UCAC, polymer, 22 residues, 7093.17192 Da.
Natural source: Common Name: Thermus thermophilus Taxonomy ID: 274 Superkingdom: Bacteria Kingdom: not available Genus/species: Thermus thermophilus
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
UCAC: GGACCCGGCUCACGCUGGGU
CC
Data type | Count |
1H chemical shifts | 89 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | UCAC | 1 |
Entity 1, UCAC 22 residues - 7093.17192 Da.
1 | G | G | A | C | C | C | G | G | C | U | ||||
2 | C | A | C | G | C | U | G | G | G | U | ||||
3 | C | C |
sample_1: UCAC, [U-13C; U-15N], 0.3 mM; D2O 99.96%
sample_conditions_1: pH: 7.000; pressure: 1 atm; temperature: 298.000 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
experiment_1 | sample_1 | solution | sample_conditions_1 |
AutoDep v4.3, AutoDep - chemical shift assignment
CNS vany, BRUNGER,ADAMS,CLORE,DELANO,GROS,GROSSE- - chemical shift assignment
PDB |