Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6477
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Theimer, C.; Blois, C.; Feigon, J.. "Structure of the human telomerase RNA pseudoknot reveals conserved tertiary
interactions essential for function." Mol. Cell 17, 671-682 (2005).
PubMed: 15749017
Assembly members:
Telomerase RNA P2b-P3 pseudoknot, polymer, 47 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semi-synthesis
Entity Sequences (FASTA):
Telomerase RNA P2b-P3 pseudoknot: GGGCUGUUUUUCUCGCUGAC
UUUCAGCCCCAAACAAAAAA
GUCAGCA
Data type | Count |
13C chemical shifts | 273 |
15N chemical shifts | 73 |
1H chemical shifts | 336 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | Telomerase RNA P2b-P3 pseudoknot | 1 |
Entity 1, Telomerase RNA P2b-P3 pseudoknot 47 residues - Formula weight is not available
1 | G | G | G | C | U | G | U | U | U | U | ||||
2 | U | C | U | C | G | C | U | G | A | C | ||||
3 | U | U | U | C | A | G | C | C | C | C | ||||
4 | A | A | A | C | A | A | A | A | A | A | ||||
5 | G | U | C | A | G | C | A |
sample_1: Telomerase RNA P2b-P3 pseudoknot 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_2: Telomerase RNA P2b-P3 pseudoknot 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%
sample_3: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N], 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_4: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N], 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%
sample_5: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-A, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_6: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-A, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%
sample_7: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-C, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_8: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-C, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%
sample_9: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-G, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_10: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-G, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%
sample_11: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-U, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; H2O 95%; D2O 5%
sample_12: Telomerase RNA P2b-P3 pseudoknot, [U-13C; U-15N]-U, 0.8 mM; sodium phosphate buffer 10 mM; KCl 200 mM; EDTA 50 uM; sodium azide 0.2%; D2O 100%
sample_cond_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 283 K
sample_cond_2: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY (11echo and watergate) | not available | not available | not available |
2D NOESY | not available | not available | not available |
2D TOCSY (presat) | not available | not available | not available |
2D 15N-HMQC | not available | not available | not available |
2D 15N-CPMG-NOESY | not available | not available | not available |
2D JNN-HNN-COSY | not available | not available | not available |
2D 13C-HSQC | not available | not available | not available |
2D HCCH COSY | not available | not available | not available |
3D HCCH-TOCSY | not available | not available | not available |
2D 13C filtered/edited NOESYs | not available | not available | not available |
xwinnmr v2.6 - collection, processing
AURELIA v3.108 - data analysis
X-PLOR NIH v1.0.6 - refinement, structure solution