Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34768
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Novotny, A.; Plavec, J.; Kocman, V.. "Structural polymorphism driven by a register shift in a CGAG-rich region found in the promoter of the neurodevelopmental regulator AUTS2 gene
" Nucleic Acids Res. 51, 2602-2613 (2023).
PubMed: 36864756
Assembly members:
entity_1, polymer, 32 residues, 9943.422 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GAGACGAGCGAGCGAAAGCA
CGAACGAGTCTC
| Data type | Count |
| 1H chemical shifts | 200 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 32 residues - 9943.422 Da.
| 1 | DG | DA | DG | DA | DC | DG | DA | DG | DC | DG | ||||
| 2 | DA | DG | DC | DG | DA | DA | DA | DG | DC | DA | ||||
| 3 | DC | DG | DA | DA | DC | DG | DA | DG | DT | DC | ||||
| 4 | DT | DC |
sample_1: DNA 0.6 ± 0.06 mM; potassium phosphate 20 ± 2 mM
sample_2: DNA 0.6 ± 0.06 mM; potassium phosphate 20 ± 2 mM
sample_3: DNA, [Residue-specific, 10% 13C/15N], 0.4 ± 0.04 mM; potassium phosphate 20 ± 2 mM
sample_4: DNA, [10 residues, 10% 13C/15N], 0.6 ± 0.06 mM; potassium phosphate 20 ± 2 mM
sample_conditions_1: ionic strength: 20 mM; pH: 7.2; pressure: 1 atm; temperature: 273 K
sample_conditions_2: ionic strength: 20 mM; pH: 7.2; pressure: 1 atm; temperature: 298 K
sample_conditions_3: ionic strength: 20 mM; pH: 7.2; pressure: 1 atm; temperature: 318 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | sample_2 | isotropic | sample_conditions_1 |
| 2D NOESY | sample_1 | isotropic | sample_conditions_3 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_3 |
| 2D 1H-31P CT-COSY | sample_1 | isotropic | sample_conditions_3 |
| 2D NOESY | sample_1 | isotropic | sample_conditions_2 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_3 | isotropic | sample_conditions_3 |
| 2D 1H-13C HSQC | sample_4 | isotropic | sample_conditions_3 |
TopSpin, Bruker Biospin - collection
NMRFAM-SPARKY, National Magnetic Resonance Facility at Madison - chemical shift assignment, data analysis
Amber v2020, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation