BMRB Entry 30730

Title:
Tandem UU:GA mismatch within an RNA helix   PubMed: 32786414
Deposition date:
2020-02-28
Original release date:
2020-08-31
Authors:
Nikonowicz, E.; Chang, A.
Citation:

Citation: Chang, A.; Chen, L.; Song, L.; Zhang, S.; Nikonowicz, E.. "2-Amino-1,3-benzothiazole-6-carboxamide Preferentially Binds the Tandem Mismatch Motif r(UY:GA)"  Biochemistry 59, 3225-3234 (2020).

Assembly members:

Assembly members:
entity_1, polymer, 28 residues, 8963.334 Da.

Natural source:

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Experimental source:

Natural source:   Common Name: not available   Taxonomy ID: 32630   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGGCUGUGAUGCUUCGGCAU AUCAGCCC

Data sets:
Data typeCount
13C chemical shifts215
15N chemical shifts51
1H chemical shifts239

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11

Entities:

Entity 1, unit_1 28 residues - 8963.334 Da.

1   GGGCUGUGAU
2   GCUUCGGCAU
3   AUCAGCCC

Samples:

sample_1: RNA 1.5 mM

sample_2: RNA, [U-99% 13C; U-99% 15N], 1.3 mM

sample_3: RNA, [U-99% 13C; U-99% 15N], 0.25 mM

sample_4: RNA, [U-99% 13C; U-99% 15N], 1.4 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 299 K

sample_conditions_2: ionic strength: 20 mM; pH: 6.8; pressure: 1 atm; temperature: 285 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
3D 1H-13C NOESYsample_2isotropicsample_conditions_1
3D HCCH-COSYsample_2isotropicsample_conditions_1
3D HCCH-TOCSYsample_2isotropicsample_conditions_1
2D 1H-13C ct-HSQCsample_3anisotropicsample_conditions_1
2D 1H-15N HSQCsample_4isotropicsample_conditions_2
2D 1H-13C ctep-HSQCsample_2isotropicsample_conditions_1
2d H(CN)Csample_2isotropicsample_conditions_1
2D H(N)COsample_4isotropicsample_conditions_2
2D 1H-1H NOESYsample_1isotropicsample_conditions_2
3D 1H-15N NOESYsample_4isotropicsample_conditions_2

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

Felix, Accelrys Software Inc. - chemical shift assignment, peak picking

NMR spectrometers:

  • Varian INOVA 600 MHz
  • Varian INOVA 500 MHz