BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 30788

Title: The FARFAR-NMR Ensemble of 29-mer HIV-1 Trans-activation Response Element RNA (N=20)

Deposition date: 2020-08-18 Original release date: 2020-10-05

Authors: Shi, H.; Rangadurai, A.; Roy, R.; Yesselman, J.; Al-Hashimi, H.

Citation: Shi, H.; Rangadurai, A.; Abou-Assi, H.; Roy, R.; Case, D.; Herschlag, D.; Yesselman, J.; Al-Hashimi, H.. "Rapid and accurate determination of atomistic RNA dynamic ensemble models using NMR and structure prediction"  .

Assembly members:
entity_1, polymer, 29 residues, 9307.555 Da.

Natural source:   Common Name: HIV-1   Taxonomy ID: 11676   Superkingdom: Viruses   Kingdom: not available   Genus/species: Lentivirus HIV-1

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):
entity_1: GGCAGAUCUGAGCCUGGGAG CUCUCUGCC

Data sets:
Data typeCount
13C chemical shifts191
15N chemical shifts8
1H chemical shifts222

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1unit_11

Entities:

Entity 1, unit_1 29 residues - 9307.555 Da.

1   GGCAGAUCUG
2   AGCCUGGGAG
3   CUCUCUGCC

Samples:

sample_1: mtTAR_E0, [U-13C; U-15N], 1.0 mM

sample_2: mtTAR_EI22, [U-13C; U-15N], 1.0 mM

sample_3: mtTAR_EII22, [U-13C; U-15N], 1.0 mM

sample_4: mtTAR_EI3, [U-13C; U-15N], 1.0 mM

sample_conditions_1: ionic strength: 25 mM; pH: 6.4; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-13C HSQCsample_1isotropicsample_conditions_1
2D 1H-13C HSQCsample_2isotropicsample_conditions_1
2D 1H-13C HSQCsample_3isotropicsample_conditions_1
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
2D 1H-13C TROSYsample_1anisotropicsample_conditions_1
2D 1H-13C TROSYsample_4anisotropicsample_conditions_1
2D 1H-13C TROSYsample_3anisotropicsample_conditions_1
2D 1H-13C TROSYsample_2anisotropicsample_conditions_1
2D 1H-13C S3CT HSQCsample_4anisotropicsample_conditions_1
2D 1H-13C S3CT HSQCsample_3anisotropicsample_conditions_1
2D 1H-13C S3CT HSQCsample_2anisotropicsample_conditions_1
2D 1H-13C S3CT HSQCsample_1anisotropicsample_conditions_1
2D 1H-15N HSQCsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_3isotropicsample_conditions_1
2D 1H-15N HSQCsample_2isotropicsample_conditions_1
2D 1H-15N HSQCsample_1isotropicsample_conditions_1
2D 1H-15N HSQC without decouplingsample_4anisotropicsample_conditions_1
2D 1H-15N HSQC without decouplingsample_3anisotropicsample_conditions_1
2D 1H-15N HSQC without decouplingsample_2anisotropicsample_conditions_1
2D 1H-15N HSQC without decouplingsample_1anisotropicsample_conditions_1

Software:

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

Sparky, Goddard - chemical shift assignment, peak picking

NMR spectrometers:

  • Bruker AVANCE III 600 MHz