Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR6633
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Gaudin, C.; Mazauric, M.; Traikia, M.; Guittet, E.; Yoshizawa, S.; Fourmy, D.. "Structure of the RNA Signal Essential for Translational Frameshifting in HIV-1" J. Mol. Biol. 349, 1024-1035 (2005).
PubMed: 15907937
Assembly members:
HIV frameshift RNA signal, polymer, 41 residues, Formula weight is not available
Natural source: Common Name: Lentivirus Taxonomy ID: 11646 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
HIV frameshift RNA signal: GGCGAUCUGGCCUUCCUACA
AGGGAAGGCCAGGGAAUUGC
C
Data type | Count |
13C chemical shifts | 273 |
15N chemical shifts | 18 |
1H chemical shifts | 351 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | HIV-1 frameshift RNA signal | 1 |
Entity 1, HIV-1 frameshift RNA signal 41 residues - Formula weight is not available
1 | G | G | C | G | A | U | C | U | G | G | ||||
2 | C | C | U | U | C | C | U | A | C | A | ||||
3 | A | G | G | G | A | A | G | G | C | C | ||||
4 | A | G | G | G | A | A | U | U | G | C | ||||
5 | C |
sample_1: HIV frameshift RNA signal 1 mM; Na phosphate buffer 10 mM; D2O 10%; H2O 90%
sample_2: HIV frameshift RNA signal 1 mM; Na phosphate buffer 10 mM; D2O 100%
sample_3: HIV frameshift RNA signal, [U-13C; U-15N], 1 mM; Na phosphate buffer 10 mM; D2O 100%
sample_cond_1: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 283 K
sample_cond_2: ionic strength: 10 mM; pH: 6.4; pressure: 1 atm; temperature: 303 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D NOESY | not available | not available | not available |
2D TOCSY | not available | not available | not available |
DQF-COSY | not available | not available | not available |
HP COSY | not available | not available | not available |
3D-HCCH-TOCSY | not available | not available | not available |
HSQC | not available | not available | not available |
3D HCP | not available | not available | not available |
xwinnmr v3.1 - processing
GIFA v4.4 - data analysis
AURELIA - data analysis
SPARKY v3.110 - data analysis
DISCOVER - refinement