BMRB Entry 34898
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34898
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Jana, J.; Weisz, K.. "Solution structure of a parallel stranded G-quadruplex formed in ORAI1 promoter" .
Assembly members:
entity_1, polymer, 24 residues, 7613.863 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TGGGCGGGGCACAGGTGGGC
GGGG
- assigned_chemical_shifts
| Data type | Count |
| 13C chemical shifts | 37 |
| 1H chemical shifts | 136 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entities:
Entity 1, unit_1 24 residues - 7613.863 Da.
| 1 | DT | DG | DG | DG | DC | DG | DG | DG | DG | DC | ||||
| 2 | DA | DC | DA | DG | DG | DT | DG | DG | DG | DC | ||||
| 3 | DG | DG | DG | DG |
Samples:
sample_1: ORAI1_1, 15N Guanine, 0.3 mM; ORAI1_2 0.3 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7; pressure: 1 atm; temperature: 313 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC | sample_1 | isotropic | sample_conditions_1 |
| 2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
| HMBC | sample_1 | isotropic | sample_conditions_1 |
Software:
CcpNmr Analysis, CCPN - chemical shift assignment
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
NMR spectrometers:
- Bruker AVANCE NEO 600 MHz