Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34674
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Wang, Z.; Jurt, S.; Dominguez-Martin, A.; Johannsen, S.; Sigel, R.. "Solution structure of an intramolecular RNA G-quadruplex formed by the 6A8U17U mutant from a 22mer guanine-rich sequence within the 5'UTR of BCL-2 proto onco-gene
" .
Assembly members:
entity_1, polymer, 22 residues, 7202.299 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGCCAUUGGGUGGGAUCUG
GG
| Data type | Count |
| 13C chemical shifts | 179 |
| 15N chemical shifts | 69 |
| 1H chemical shifts | 184 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
Entity 1, unit_1 22 residues - 7202.299 Da.
| 1 | G | G | G | C | C | A | U | U | G | G | ||||
| 2 | G | U | G | G | G | A | U | C | U | G | ||||
| 3 | G | G |
sample_1: BCL-2 6A8U17U 1.0 mM
sample_2: BCL-2 6A8U17U 1.0 mM
sample_3: BCL-2 6A8U17U, [G & U 15N-labeled], 0.5 mM
sample_4: BCL-2 6A8U17U, [G & U 15N-labeled], 0.5 mM
sample_5: BCL-2 6A8U17U, [A & C 15N-labeled], 0.5 mM
sample_6: BCL-2 6A8U17U, [A 13C, 15N-labeled], 0.5 mM
sample_7: BCL-2 6A8U17U, [C 13C, 15N-labeled], 0.3 mM
sample_8: BCL-2 6A8U17U, [G 13C-labeled], 0.3 mM
sample_9: BCL-2 6A8U17U, [U 13C, 15N-labeled], 0.5 mM
sample_conditions_1: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_2: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_3: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_4: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_5: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_6: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_7: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_8: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
sample_conditions_9: ionic strength: 2 mM; pH: 7.0; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-13C HSQC | sample_2 | isotropic | sample_conditions_2 |
| 2D 1H-15N HSQC | sample_3 | isotropic | sample_conditions_3 |
| JR-HMBC | sample_1 | isotropic | sample_conditions_1 |
| H8N2 HNN-COSY | sample_3 | isotropic | sample_conditions_3 |
| H1N2 HNN-COSY | sample_3 | isotropic | sample_conditions_3 |
| H1pC6/8 HMBC | sample_2 | isotropic | sample_conditions_2 |
| long-range 1H-15N HSQC | sample_4 | isotropic | sample_conditions_4 |
| long-range 1H-15N HSQC | sample_5 | isotropic | sample_conditions_5 |
| constant-time 1H-13C HSQC | sample_6 | isotropic | sample_conditions_6 |
| constant-time 1H-13C HSQC | sample_7 | isotropic | sample_conditions_7 |
| constant-time 1H-13C HSQC | sample_8 | isotropic | sample_conditions_8 |
| constant-time 1H-13C HSQC | sample_9 | isotropic | sample_conditions_9 |
TopSpin v4.0.6, Bruker Biospin - collection
NMRFAM-SPARKY v1.414, Lee W, Tonelli M, Markley JL - chemical shift assignment, peak picking
X-PLOR NIH v3.0, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation