Click here to enlarge.
PDB ID: 6ccw
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30402
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lin, C.; Wu, G.; Wang, K.; Onel, B.; Sakai, S.; Shao, Y.; Yang, D.. "Molecular Recognition of the Hybrid-2 Human Telomeric G-quadruplex by Epiberberine: Insights into Conversion of Telomeric G-quadruplex Structures." Angew. Chem. Int. Ed. Engl. 57, 10888-10893 (2018).
PubMed: 29888501
Assembly members:
entity_1, polymer, 26 residues, 8200.269 Da.
entity_EWV, non-polymer, 336.361 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTAGGGTTAGGGTTAGGGTT
AGGGTT
Data type | Count |
1H chemical shifts | 285 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
2 | entity_2 | 2 |
Entity 1, entity_1 26 residues - 8200.269 Da.
1 | DT | DT | DA | DG | DG | DG | DT | DT | DA | DG | ||||
2 | DG | DG | DT | DT | DA | DG | DG | DG | DT | DT | ||||
3 | DA | DG | DG | DG | DT | DT |
Entity 2, entity_2 - C20 H18 N O4 - 336.361 Da.
1 | EWV |