Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5170
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: DeJong, E.; Marzluff, W.; Nikonowicz, E.. "NMR Structure and Dynamics of the RNA-binding Site for the Histone mRNA
Stem-Loop Binding Protein
" RNA 8, 83-96 (2002).
PubMed: 11871662
Assembly members:
Histone mRNA, polymer, 28 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: .
Entity Sequences (FASTA):
Histone mRNA: GGCCCUUUUCAGGGCCCAGG
GCCACCCA
| Data type | Count |
| 13C chemical shifts | 128 |
| 15N chemical shifts | 14 |
| 1H chemical shifts | 139 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | Histone mRNA | 1 |
Entity 1, Histone mRNA 28 residues - Formula weight is not available
| 1 | G | G | C | C | C | U | U | U | U | C | ||||
| 2 | A | G | G | G | C | C | C | A | G | G | ||||
| 3 | G | C | C | A | C | C | C | A |
sample_1: Histone mRNA, [U-13C], 2.3 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 100%
sample_2: Histone mRNA, [U-15N], 2.5 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 10%; H2O 90%
sample_3: Histone mRNA, [U-13C], [U-2H]-H5',H5'', 2.0 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 100%
sample_4: Histone mRNA 2.8 mM; KPi 20 mM; KCl 20 mM; EDTA 0.02 mM; D2O 100%
sample_cond_1: pH: 6.8; temperature: 280 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| NOESY | not available | not available | sample_cond_1 |
| 3D 13C-separated NOESY | not available | not available | sample_cond_1 |
| 3D 15N-separated NOESY | not available | not available | sample_cond_1 |
| DQF-COSY | not available | not available | sample_cond_1 |
| HetCor | not available | not available | sample_cond_1 |
FELIX v980 - processing
X-PLOR v3.851 - refinement