Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR4250
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kolk, M.; van der Graaf, M.; Fransen, C.; Wijmenga, S.; Pleij, C.; Heus, H.; Hilbers, C.. "Structure of the 3' hairpin of the TYMV pseudoknot: Preformation in RNA folding" EMBO J. 17, 7498-7504 (1998).
Assembly members:
3' hairpin of TYMV pseudoknot, polymer, 23 residues, Formula weight is not available
Natural source: Common Name: TYMV Taxonomy ID: 12154 Superkingdom: viruses Kingdom: not available Genus/species: Tymovirus Turnip yellow mosaic virus
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
3' hairpin of TYMV pseudoknot: GGUUCCGAGGGUCAUCGGAA
CCA
Data type | Count |
1H chemical shifts | 149 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | TYMV-RNA | 1 |
Entity 1, TYMV-RNA 23 residues - Formula weight is not available
1 | G | G | U | U | C | C | G | A | G | G | ||||
2 | G | U | C | A | U | C | G | G | A | A | ||||
3 | C | C | A |
sample_one: 3' hairpin of TYMV pseudoknot 3.5 mM
sample_conditions_one: pH*: 6.8; temperature: 295 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
NOESY | sample_one | not available | sample_conditions_one |
DQF COSY | sample_one | not available | sample_conditions_one |
{31P-1H} HETCOR | sample_one | not available | sample_conditions_one |
{13C-1H} HMQC | sample_one | not available | sample_conditions_one |
No software information available