Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5528
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Park, C.-J.; Bae, S.-H.; Lee, M.-K.; Varani, G.; Choi, B.-S.. "Solution Structure of the Influenza A Virus cRNA Promoter: Implications for Differential
Recognition of Viral Promoter Structures by RNA-dependent RNA Polymerase" Nucleic Acids Res. 31, 2824-2832 (2003).
PubMed: 12771209
Assembly members:
complementary RNA promoter of influenza virus, polymer, 25 residues, Formula weight is not available
Natural source: Common Name: influenza A virus Taxonomy ID: 11320 Superkingdom: not available Kingdom: not available Genus/species: influenzavirus A not available
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
complementary RNA promoter of influenza virus: GGAAGCAGGCUUCGGCCUUG
UUUCC
| Data type | Count |
| 31P chemical shifts | 13 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | complementary RNA promoter | 1 |
Entity 1, complementary RNA promoter 25 residues - Formula weight is not available
| 1 | G | G | A | A | G | C | A | G | G | C | ||||
| 2 | U | U | C | G | G | C | C | U | U | G | ||||
| 3 | U | U | U | C | C |
sample_1: complementary RNA promoter of influenza virus 1 mM; phosphate buffer 20 mM; EDTA 0.1 mM; H2O 90%; D2O 10%
sample_2: complementary RNA promoter of influenza virus, [U-15N; U-13C], 1 mM; phosphate buffer 20 mM; EDTA 0.1 mM; D2O 100%
sample_cond_1: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 300 K
sample_cond_2: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 280 K
sample_cond_3: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 290 K
sample_cond_4: ionic strength: 20 mM; pH: 6.0; pressure: 1 atm; temperature: 310 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | not available |
| 2D TOCSY | not available | not available | not available |
| DQF-COSY | not available | not available | not available |
| HETCOR | not available | not available | not available |
| 3D 13C NOESY-HSQC | not available | not available | not available |
| 3D HCCH-COSY | not available | not available | not available |
| 3D HCCH-COSY-TOCSY | not available | not available | not available |
FELIX v95 - processing
VNMR v6.1c - collection
CNS v1.0 - refinement, structure solution