BMRB Entry 5553

Solution structure of influenza A virus C4 promoter   PubMed: 12582241
Deposition date:
Original release date:
Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.

Citation: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.. "A Single-nucleotide Natural Variation (U4 to C4) in an Influenza A Virus Promoter Exhibits a Large Structural Change: Implications for Differential Viral RNA Synthesis by RNA-dependent RNA Polymerase"  Nucleic Acids Res. 31, 1216-1223 (2003).

Assembly members:

Assembly members:
C4 promoter of influneza A virus, polymer, 31 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Influenzavirus A   Taxonomy ID: 197911   Superkingdom: Viruses   Kingdom: not available   Genus/species: Influenzavirus A not available

Experimental source:   Production method: .

Experimental source:

Natural source:   Common Name: Influenzavirus A   Taxonomy ID: 197911   Superkingdom: Viruses   Kingdom: not available   Genus/species: Influenzavirus A not available

Experimental source:   Production method: .

Entity Sequences (FASTA):

Entity Sequences (FASTA):
C4 promoter of influneza A virus: AGUAGAAACAAGGCUUCGGC CUGCUUUCGCU

Data sets:
Data typeCount
13C chemical shifts29
15N chemical shifts11
31P chemical shifts18

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all


Entity Assembly IDEntity NameEntity ID
1C4 promoter of influneza A virus1


Entity 1, C4 promoter of influneza A virus 31 residues - Formula weight is not available

4   U


sample_1: C4 promoter of influneza A virus 1 mM; H2O 90%; D2O 10%

sample_2: C4 promoter of influneza A virus 1 mM; D2O 99.96%

sample_3: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; H2O 90%; D2O 10%

sample_4: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; D2O 99.96%

sample_cond_1: pH: .; temperature: . .


NameSampleSample stateSample conditions
2D NOESYnot availablenot availablesample_cond_1
DQF-COSYnot availablenot availablesample_cond_1
3D HCCH-COSYnot availablenot availablesample_cond_1


CNS v1.0 - refinement, structure solution

NMRPipe v2.1 - processing

NMR spectrometers:

  • Varian INOVA 600 MHz