Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5553
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Lee, M.-K.; Bae, S.-H.; Park, C.-J.; Cheong, H.-K.; Cheong, C.; Choi, B.-S.. "A Single-nucleotide Natural Variation (U4 to C4) in an Influenza A Virus
Promoter Exhibits a Large Structural Change: Implications for Differential
Viral RNA Synthesis by RNA-dependent RNA Polymerase
" Nucleic Acids Res. 31, 1216-1223 (2003).
PubMed: 12582241
Assembly members:
C4 promoter of influneza A virus, polymer, 31 residues, Formula weight is not available
Natural source: Common Name: Influenzavirus A Taxonomy ID: 197911 Superkingdom: Viruses Kingdom: not available Genus/species: Influenzavirus A not available
Experimental source: Production method: .
Entity Sequences (FASTA):
C4 promoter of influneza A virus: AGUAGAAACAAGGCUUCGGC
CUGCUUUCGCU
| Data type | Count |
| 13C chemical shifts | 29 |
| 15N chemical shifts | 11 |
| 31P chemical shifts | 18 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | C4 promoter of influneza A virus | 1 |
Entity 1, C4 promoter of influneza A virus 31 residues - Formula weight is not available
| 1 | A | G | U | A | G | A | A | A | C | A | ||||
| 2 | A | G | G | C | U | U | C | G | G | C | ||||
| 3 | C | U | G | C | U | U | U | C | G | C | ||||
| 4 | U |
sample_1: C4 promoter of influneza A virus 1 mM; H2O 90%; D2O 10%
sample_2: C4 promoter of influneza A virus 1 mM; D2O 99.96%
sample_3: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; H2O 90%; D2O 10%
sample_4: C4 promoter of influneza A virus, [U-13C; U-15N], 1 mM; D2O 99.96%
sample_cond_1: pH: .; temperature: . .
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | sample_cond_1 |
| DQF-COSY | not available | not available | sample_cond_1 |
| 3D HCCH-COSY | not available | not available | sample_cond_1 |
CNS v1.0 - refinement, structure solution
NMRPipe v2.1 - processing