Click here to enlarge.
PDB ID: 7t1n
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30971
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Pham, V.; Gao, M.; Meagher, J.; Smith, J.; D'Souza, V.. "A structure-based mechanism for displacement of the HEXIM adapter from 7SK small nuclear RNA" Commun. Biol. 5, 819-819 (2022).
PubMed: 35970937
Assembly members:
entity_1, polymer, 56 residues, 17986.635 Da.
entity_2, polymer, 19 residues, 2285.681 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAUCUGUCACCCCAUUGA
UCGCCAGUGGCUGAUCUGGC
UGGCUAGGCGGGUCCC
entity_2: GISYGRQLGKKKHRRRAHQ
Data type | Count |
13C chemical shifts | 123 |
15N chemical shifts | 50 |
1H chemical shifts | 230 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
2 | unit_2 | 2 |
Entity 1, unit_1 56 residues - 17986.635 Da.
1 | G | G | G | A | U | C | U | G | U | C | ||||
2 | A | C | C | C | C | A | U | U | G | A | ||||
3 | U | C | G | C | C | A | G | U | G | G | ||||
4 | C | U | G | A | U | C | U | G | G | C | ||||
5 | U | G | G | C | U | A | G | G | C | G | ||||
6 | G | G | U | C | C | C |
Entity 2, unit_2 19 residues - 2285.681 Da.
1 | GLY | ILE | SER | TYR | GLY | ARG | GLN | LEU | GLY | LYS | ||||
2 | LYS | LYS | HIS | ARG | ARG | ARG | ALA | HIS | GLN |
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks