Click here to enlarge.
PDB ID: 6noa
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR30560
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Walker, M.; Shortridge, M.; Albin, D.; Cominsky, L.; Varani, G.. "Structure of the RNA Specialized Translation Initiation Element that Recruits eIF3 to the 5'-UTR of c-Jun" J. Mol. Biol. 432, 1841-1855 (2020).
PubMed: 31953146
Assembly members:
entity_1, polymer, 56 residues, 17634.342 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCAGUAUAGUCCGAACUGC
AAAUCUUAUUUUCUUUUCAC
CUUCUCUCUAACUGCC
Data type | Count |
13C chemical shifts | 291 |
15N chemical shifts | 12 |
1H chemical shifts | 404 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 56 residues - 17634.342 Da.
1 | G | G | C | A | G | U | A | U | A | G | ||||
2 | U | C | C | G | A | A | C | U | G | C | ||||
3 | A | A | A | U | C | U | U | A | U | U | ||||
4 | U | U | C | U | U | U | U | C | A | C | ||||
5 | C | U | U | C | U | C | U | C | U | A | ||||
6 | A | C | U | G | C | C |