BMRB Entry 31008

Name: DENV1 SLA RNA (DenvSLATL)
Published: 2022-06-30

Click here to enlarge.

PDB ID: 7umc
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR31008
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

DENV1 SLA RNA (DenvSLATL)

Deposition date:

2022-04-06

Original release date:

2022-06-30

Authors:

Sun, Y.; Varani, G.; Seattle Structural Genomics Center for Infectious Disease (SSGCID), .

Citation:

Citation: Sun, Y.; Varani, G.. "Structure of the Dengue Virus RNA Promoter" RNA 28, 1210-1223 (2022).
PubMed: 35750488

Assembly members:

Assembly members:
entity_1, polymer, 70 residues, 22614.471 Da.

Natural source:

Natural source: Common Name: Dengue virus 1 Taxonomy ID: 11053 Superkingdom: Viruses Kingdom: not available Genus/species: Flavivirus Dengue virus 1

Experimental source:

Experimental source: Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGAGUGGUUAGUCUACGUGG ACCGACAAGACUUCGGUCGA AUCGGAAGGAAACUUAACGU AGUUCUAACC

Data sets:

assigned_chemical_shifts
- assigned_chemical_shifts_1

Data type	Count
1H chemical shifts	185

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	unit_1	1

Entities:

Entity 1, unit_1 70 residues - 22614.471 Da.

1	G	G	A	G	U	G	G	U	U	A
2	G	U	C	U	A	C	G	U	G	G
3	A	C	C	G	A	C	A	A	G	A
4	C	U	U	C	G	G	U	C	G	A
5	A	U	C	G	G	A	A	G	G	A
6	A	A	C	U	U	A	A	C	G	U
7	A	G	U	U	C	U	A	A	C	C

Samples:

sample_1: RNA (70-MER) 1 mM; potassium phosphate 10 mM

sample_2: RNA (70-MER), [U-2H], 1 mM; potassium phosphate 10 mM

sample_3: RNA (70-MER) 1 mM; potassium phosphate 10 mM

sample_conditions_1: ionic strength: 50 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D 1H-1H NOESY	sample_1	isotropic	sample_conditions_1
2D 1H-1H TOCSY	sample_1	isotropic	sample_conditions_1
2D 1H-1H NOESY	sample_2	isotropic	sample_conditions_1
2D 1H-1H TOCSY	sample_2	isotropic	sample_conditions_1
2D 1H-1H NOESY	sample_3	isotropic	sample_conditions_1

Software:

TopSpin, Bruker Biospin - collection, processing

NMRFAM-SPARKY, Lee W, Tonelli M, Markley JL - peak picking

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

NMR spectrometers:

Bruker AVANCE III 600 MHz
Bruker AVANCE III 800 MHz

1	G	G	A	G	U	G	G	U	U	A
2	G	U	C	U	A	C	G	U	G	G
3	A	C	C	G	A	C	A	A	G	A
4	C	U	U	C	G	G	U	C	G	A
5	A	U	C	G	G	A	A	G	G	A
6	A	A	C	U	U	A	A	C	G	U
7	A	G	U	U	C	U	A	A	C	C

1	G	G	A	G	U	G	G	U	U	A
2	G	U	C	U	A	C	G	U	G	G
3	A	C	C	G	A	C	A	A	G	A
4	C	U	U	C	G	G	U	C	G	A
5	A	U	C	G	G	A	A	G	G	A
6	A	A	C	U	U	A	A	C	G	U
7	A	G	U	U	C	U	A	A	C	C

1	G	G	A	G	U	G	G	U	U	A
2	G	U	C	U	A	C	G	U	G	G
3	A	C	C	G	A	C	A	A	G	A
4	C	U	U	C	G	G	U	C	G	A
5	A	U	C	G	G	A	A	G	G	A
6	A	A	C	U	U	A	A	C	G	U
7	A	G	U	U	C	U	A	A	C	C