Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR17408
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Davidson, Amy; Begley, Darren; Lau, Carmen; Varani, Gabriele. "A small-molecule probe induces a conformation in HIV TAR RNA capable of binding drug-like fragments" J. Mol. Biol. 410, 984-996 (2011).
PubMed: 21763501
Assembly members:
HIV_TAR_RNA, polymer, 29 residues, 132.116 Da.
ARG, non-polymer, 175.209 Da.
L8H, non-polymer, 173.211 Da.
Natural source: Common Name: HIV-1 Taxonomy ID: 11676 Superkingdom: Viruses Kingdom: not available Genus/species: Lentivirus HIV-1
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
HIV_TAR_RNA: GGCAGAUCUGAGCCUGGGAG
CUCUCUGCC
| Data type | Count |
| 1H chemical shifts | 177 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | HIV TAR RNA | 1 |
| 2 | ARGININE | 2 |
| 3 | 4-METHOXYNAPHTHALEN-2-AMINE | 3 |
Entity 1, HIV TAR RNA 29 residues - 132.116 Da.
| 1 | G | G | C | A | G | A | U | C | U | G | ||||
| 2 | A | G | C | C | U | G | G | G | A | G | ||||
| 3 | C | U | C | U | C | U | G | C | C |
Entity 2, ARGININE - C6 H15 N4 O2 - 175.209 Da.
| 1 | ARG |
Entity 3, 4-METHOXYNAPHTHALEN-2-AMINE - C11 H11 N O - 173.211 Da.
| 1 | L8H |
sample_1: HIV TAR RNA 1 mM; ARGININE 4 mM; 4-METHOXYNAPHTHALEN-2-AMINE 4 mM; potassium phosphate 10 mM
sample_2: HIV TAR RNA 1 mM; ARGININE 4 mM; 4-METHOXYNAPHTHALEN-2-AMINE 4 mM; potassium phosphate 10 mM
sample_3: HIV TAR RNA, [U-100% 13C; U-100% 15N], 1 mM; ARGININE 4 mM; 4-METHOXYNAPHTHALEN-2-AMINE 4 mM; potassium phosphate 10 mM
sample_conditions_2: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 277 K
sample_conditions_1: ionic strength: 10 mM; pH: 6.6; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 1H-1H NOESY with WATERGATE | sample_2 | isotropic | sample_conditions_2 |
| 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| HCCH-COSY | sample_3 | isotropic | sample_conditions_1 |
| 13C HSQC-NOESY | sample_3 | isotropic | sample_conditions_1 |
X-PLOR, Brunger A. T. et.al. - refinement