Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full, SPARTA
BMRB Entry DOI: doi:10.13018/BMR25888
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Eustermann, Sebastian; Wu, Wing-Fung; Langelier, Marie-France; Yang, Ji-Chun; Easton, Laura; Riccio, Amanda; Pascal, John; Neuhaus, David. "Structural basis of detection and signaling of DNA single-strand breaks by human PARP 1
" Mol. Cell 60, 742-754 (2015).
PubMed: 26626479
Assembly members:
F1F2, polymer, 214 residues, 24106.734 Da.
DNA_(45-MER), polymer, . residues, 13871.971 Da.
entity_ZN, non-polymer, 65.409 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: recombinant technology Host organism: Escherichia coli Vector: Pet13
Entity Sequences (FASTA):
F1F2: MAESSDKLYRVEYAKSGRAS
CKKCSESIPKDSLRMAIMVQ
SPMFDGKVPHWYHFSCFWKV
GHSIRHPDVEVDGFSELRWD
DQQKVKKTAEAGGVTGKGQD
GIGSKAEKTLGDFAAEYAKS
NRSTCKGCMEKIEKGQVRLS
KKMVDPEKPQLGMIDRWYHP
GCFVKNREELGFRPEYSASQ
LKGFSLLATEDKEALKKQLP
GVKSEGKRKGDEVD
DNA_(45-MER): GCTGGCTTCGTAAGAAGCCA
GCTCGCGGTCAGCTTGCTGA
CCGCG
| Data type | Count |
| 13C chemical shifts | 272 |
| 15N chemical shifts | 396 |
| 1H chemical shifts | 896 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | F1F2 | 1 |
| 2 | DNA (45-MER) | 2 |
| 3 | ZN, 1 | 3 |
| 4 | ZN, 2 | 3 |
Entity 1, F1F2 214 residues - 24106.734 Da.
| 1 | MET | ALA | GLU | SER | SER | ASP | LYS | LEU | TYR | ARG | ||||
| 2 | VAL | GLU | TYR | ALA | LYS | SER | GLY | ARG | ALA | SER | ||||
| 3 | CYS | LYS | LYS | CYS | SER | GLU | SER | ILE | PRO | LYS | ||||
| 4 | ASP | SER | LEU | ARG | MET | ALA | ILE | MET | VAL | GLN | ||||
| 5 | SER | PRO | MET | PHE | ASP | GLY | LYS | VAL | PRO | HIS | ||||
| 6 | TRP | TYR | HIS | PHE | SER | CYS | PHE | TRP | LYS | VAL | ||||
| 7 | GLY | HIS | SER | ILE | ARG | HIS | PRO | ASP | VAL | GLU | ||||
| 8 | VAL | ASP | GLY | PHE | SER | GLU | LEU | ARG | TRP | ASP | ||||
| 9 | ASP | GLN | GLN | LYS | VAL | LYS | LYS | THR | ALA | GLU | ||||
| 10 | ALA | GLY | GLY | VAL | THR | GLY | LYS | GLY | GLN | ASP | ||||
| 11 | GLY | ILE | GLY | SER | LYS | ALA | GLU | LYS | THR | LEU | ||||
| 12 | GLY | ASP | PHE | ALA | ALA | GLU | TYR | ALA | LYS | SER | ||||
| 13 | ASN | ARG | SER | THR | CYS | LYS | GLY | CYS | MET | GLU | ||||
| 14 | LYS | ILE | GLU | LYS | GLY | GLN | VAL | ARG | LEU | SER | ||||
| 15 | LYS | LYS | MET | VAL | ASP | PRO | GLU | LYS | PRO | GLN | ||||
| 16 | LEU | GLY | MET | ILE | ASP | ARG | TRP | TYR | HIS | PRO | ||||
| 17 | GLY | CYS | PHE | VAL | LYS | ASN | ARG | GLU | GLU | LEU | ||||
| 18 | GLY | PHE | ARG | PRO | GLU | TYR | SER | ALA | SER | GLN | ||||
| 19 | LEU | LYS | GLY | PHE | SER | LEU | LEU | ALA | THR | GLU | ||||
| 20 | ASP | LYS | GLU | ALA | LEU | LYS | LYS | GLN | LEU | PRO | ||||
| 21 | GLY | VAL | LYS | SER | GLU | GLY | LYS | ARG | LYS | GLY | ||||
| 22 | ASP | GLU | VAL | ASP |
Entity 2, DNA (45-MER) - 13871.971 Da.
| 1 | DG | DC | DT | DG | DG | DC | DT | DT | DC | DG | ||||
| 2 | DT | DA | DA | DG | DA | DA | DG | DC | DC | DA | ||||
| 3 | DG | DC | DT | DC | DG | DC | DG | DG | DT | DC | ||||
| 4 | DA | DG | DC | DT | DT | DG | DC | DT | DG | DA | ||||
| 5 | DC | DC | DG | DC | DG |
Entity 3, ZN, 1 - Zn - 65.409 Da.
| 1 | ZN |
sample_1: PARP-1 1-214, [U-15N; U-13C; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%
sample_2: PARP-1 1-214, [U-15N; U-13C; U-70% 2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%
sample_3: PARP-1 1-214, [U-98% 2H; U-98% 15N], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%
sample_4a: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%
sample_4b: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_5: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_6: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_7: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_8: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_9: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; H2O 95%; D2O, [U-2H], 5%
sample_10: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_11: PARP-1 1-214, see Sample details section, 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
sample_1_D2O: PARP-1 1-214, [U-15N; U-13C; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 mM; D2O, [U-2H], 100%
bound_F1F2_high_salt: PARP-1 1-214, [U-15N; U-13C; U-2H], 0.2 mM; DNA (45-MER) 0.2 mM; TRIS, [U-2H], 50 mM; DTT, [U-2H], 1 mM; ZnSO4 0.1 uM; sodium chloride 200 mM; H2O 95%; D2O, [U-2H], 5%
sample_conditions_1: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K
sample_conditions_2: ionic strength: 0.05 M; pH: 7.2; pressure: 1 atm; temperature: 273 K
sample_conditions_3: ionic strength: 0.25 M; pH: 7.2; pressure: 1 atm; temperature: 273 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-15N TROSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HMQC | sample_1 | isotropic | sample_conditions_1 |
| TROSY-NHCACB (optimized for CB) | sample_1 | isotropic | sample_conditions_1 |
| TROSY-HNCA | sample_1 | isotropic | sample_conditions_1 |
| TROSY-HN(CO)CA | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-13C HMQC | sample_2 | isotropic | sample_conditions_1 |
| TROSY-HNCA | sample_2 | isotropic | sample_conditions_1 |
| TROSY-HN(CO)CA | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | sample_3 | isotropic | sample_conditions_1 |
| 3D 1H-13C-1H NOESY-HMQC | sample_4a | isotropic | sample_conditions_1 |
| HMCM(CG)CBCA | sample_4b | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_5 | isotropic | sample_conditions_1 |
| 3D 13C-13C-1H HMQC-NOESY-HMQC | sample_5 | isotropic | sample_conditions_1 |
| 3D 1H-13C-1H NOESY-HMQC | sample_5 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_6 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 | sample_7 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 (no decoupling in w1) | sample_7 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 | sample_8 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 (no decoupling in w1) | sample_8 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 (no decoupling in w1) | sample_9 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 | sample_10 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_11 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY filtered to accept 13C-1H in w2 | sample_11 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1_D2O | isotropic | sample_conditions_1 |
| 2D 1H-15N TROSY | bound_F1F2_high_salt | isotropic | sample_conditions_3 |
X-PLOR_NIH v2.28, Schwieters, Kuszewski, Tjandra and Clore - structure solution
SPARKY v3.115, Goddard - chemical shift assignment
TOPSPIN v2.1, Bruker Biospin - processing
Analysis v2.4.1, CCPN - chemical shift assignment, data analysis
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - data analysis
Download HSQC peak lists in one of the following formats:
CSV: Backbone
or all simulated peaks
SPARKY: Backbone
or all simulated peaks