BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 25888

Title: 1H, 13C and 15N chemical shift assignments and solution structure for PARP-1 F1F2 domains in complex with a DNA single-strand break   PubMed: 26626479

Deposition date: 2015-10-08 Original release date: original

Authors: Neuhaus, David; ., Eustermann; ., .; ., .

Citation: Eustermann, Sebastian; ., Wu; ., .; ., .; ., .; 25888, .; 8, 25888; , . "Structural basis of detection and signaling of DNA single-strand breaks by human PARP 1"  Mol. Cell 60, 742-754 (2015).

Assembly members:
F1F2, polymer, 214 residues, 24106.734 Da.
DNA_(45-MER), polymer, . residues, 13871.971 Da.
entity_ZN, non-polymer, 65.409 Da.

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: recombinant technology' 'Escherichia coli

Entity Sequences (FASTA):
F1F2: MAESSDKLYRVEYAKSGRAS CKKCSESIPKDSLRMAIMVQ SPMFDGKVPHWYHFSCFWKV GHSIRHPDVEVDGFSELRWD DQQKVKKTAEAGGVTGKGQD GIGSKAEKTLGDFAAEYAKS NRSTCKGCMEKIEKGQVRLS KKMVDPEKPQLGMIDRWYHP GCFVKNREELGFRPEYSASQ LKGFSLLATEDKEALKKQLP GVKSEGKRKGDEVD
DNA_(45-MER): GCTGGCTTCGTAAGAAGCCA GCTCGCGGTCAGCTTGCTGA CCGCG

Data sets:
Data typeCount
13C chemical shifts272
3961H chemical shifts

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all