BMRB

Biological Magnetic Resonance Data Bank


A Repository for Data from NMR Spectroscopy on Proteins, Peptides, Nucleic Acids, and other Biomolecules
Member of WWPDB

BMRB Entry 19747

Title: 13C and 15N Chemical Shift Assignments for the M13 Bacteriophage   PubMed: 22085310

Deposition date: 2014-01-21 Original release date: 2014-06-05

Authors: Morag, Omry; Goldbourt, Amir

Citation: Morag, Omry; Abramov, Gili; Goldbourt, Amir. "Similarities and differences within members of the Ff family of filamentous bacteriophage viruses."  J Phys Chem B 115, 15370-15379 (2011).

Assembly members:
M13_bacteriophage, polymer, 50 residues, 22000000 Da.
ssDNA, polymer, 8669 residues, Formula weight is not available

Natural source:   Common Name: not available   Taxonomy ID: 38018   Superkingdom: not available   Kingdom: not available   Genus/species: not available not available

Experimental source:   Production method: purified from the natural source' 'Escherichia coli' . . . Escherichia coli Dh5a . . . . . . . . . . . . 'other virus

Entity Sequences (FASTA):
M13_bacteriophage: AEGDDPAKAAFNSLQASATE YIGYAWAMVVVIVGATIGIK LFKKFTSKAS
ssDNA: AACGCTACTACTATTAGTAG AATTGATGCCACCTTTTCAG CTCGCGCCCCAAATGAAAAT ATAGCTAAACAGGTTATTGA CCATTTGCGAAATGTATCTA ATGGTCAAACTAAATCTACT CGTTCGCAGAATTGGGAATC AACTGTTACATGGAATGAAA CTTCCAGACACCGTACTTTA GTTGCATATTTAAAACATGT TGAGCTACAGCACCAGATTC AGCAATTAAGCTCTAAGCCA TCCGCAAAAATGACCTCTTA TCAAAAGGAGCAATTAAAGG TACTCTCTAATCCTGACCTG TTGGAGTTTGCTTCCGGTCT GGTTCGCTTTGAAGCTCGAA TTAAAACGCGATATTTGAAG TCTTTCGGGCTTCCTCTTAA TCTTTTTGATGCAATCCGCT TTGCTTCTGACTATAATAGT CAGGGTAAAGACCTGATTTT TGATTTATGGTCATTCTCGT TTTCTGAACTGTTTAAAGCA TTTGAGGGGGATTCAATGAA TATTTATGACGATTCCGCAG TATTGGACGCTATCCAGTCT AAACATTTTACTATTACCCC CTCTGGCAAAACTTCTTTTG CAAAAGCCTCTCGCTATTTT GGTTTTTATCGTCGTCTGGT AAACGAGGGTTATGATAGTG TTGCTCTTACTATGCCTCGT AATTCCTTTTGGCGTTATGT ATCTGCATTAGTTGAATGTG GTATTCCTAAATCTCAACTG ATGAATCTTTCTACCTGTAA TAATGTTGTTCCGTTAGTTC GTTTTATTAACGTAGATTTT TCTTCCCAACGTCCTGACTG GTATAATGAGCCAGTTCTTA AAATCGCATAAGGTAATTCA CAATGATTAAAGTTGAAATT AAACCATCTCAAGCCCAATT TACTACTCGTTCTGGTGTTT CTCGTCAGGGCAAGCCTTAT TCACTGAATGAGCAGCTTTG TTACGTTGATTTGGGTAATG AATATCCGGTTCTTGTCAAG ATTACTCTTGATGAAGGTCA GCCAGCCTATGCGCCTGGTC TGTACACCGTTCATCTGTCC TCTTTCAAAGTTGGTCAGTT CGGTTCCCTTATGATTGACC GTCTGCGCCTCGTTCCGGCT AAGTAACATGGAGCAGGTCG CGGATTTCGACACAATTTAT CAGGCGATGATACAAATCTC CGTTGTACTTTGTTTCGCGC TTGGTATAATCGCTGGGGGT CAAAGATGAGTGTTTTAGTG TATTCTTTCGCCTCTTTCGT TTTAGGTTGGTGCCTTCGTA GTGGCATTACGTATTTTACC CGTTTAATGGAAACTTCCTC ATGAAAAAGTCTTTAGTCCT CAAAGCCTCTGTAGCCGTTG CTACCCTCGTTCCGATGCTG TCTTTCGCTGCTGAGGGTGA CGATCCCGCAAAAGCGGCCT TTAACTCCCTGCAAGCCTCA GCGACCGAATATATCGGTTA TGCGTGGGCGATGGTTGTTG TCATTGTCGGCGCAACTATC GGTATCAAGCTGTTTAAGAA ATTCACCTCGAAAGCAAGCT GATAAACCGATACAATTAAA GGCTCCTTTTGGAGCCTTTT TTTTTGGAGATTTTCAACGT GAAAAAATTATTATTCGCAA TTCCTTTAGTTGTTCCTTTC TATTCTCACTCCGCTGAAAC TGTTGAAAGTTGTTTAGCAA AACCCCATACAGAAAATTCA TTTACTAACGTCTGGAAAGA CGACAAAACTTTAGATCGTT ACGCTAACTATGAGGGTTGT CTGTGGAATGCTACAGGCGT TGTAGTTTGTACTGGTGACG AAACTCAGTGTTACGGTACA TGGGTTCCTATTGGGCTTGC TATCCCTGAAAATGAGGGTG GTGGCTCTGAGGGTGGCGGT TCTGAGGGTGGCGGTTCTGA GGGTGGCGGTACTAAACCTC CTGAGTACGGTGATACACCT ATTCCGGGCTATACTTATAT CAACCCTCTCGACGGCACTT ATCCGCCTGGTACTGAGCAA AACCCCGCTAATCCTAATCC TTCTCTTGAGGAGTCTCAGC CTCTTAATACTTTCATGTTT CAGAATAATAGGTTCCGAAA TAGGCAGGGGGCATTAACTG TTTATACGGGCACTGTTACT CAAGGCACTGACCCCGTTAA AACTTATTACCAGTACACTC CTGTATCATCAAAAGCCATG TATGACGCTTACTGGAACGG TAAATTCAGAGACTGCGCTT TCCATTCTGGCTTTAATGAG GATCCATTCGTTTGTGAATA TCAAGGCCAATCGTCTGACC TGCCTCAACCTCCTGTCAAT GCTGGCGGCGGCTCTGGTGG TGGTTCTGGTGGCGGCTCTG AGGGTGGTGGCTCTGAGGGT GGCGGTTCTGAGGGTGGCGG CTCTGAGGGAGGCGGTTCCG GTGGTGGCTCTGGTTCCGGT GATTTTGATTATGAAAAGAT GGCAAACGCTAATAAGGGGG CTATGACCGAAAATGCCGAT GAAAACGCGCTACAGTCTGA CGCTAAAGGCAAACTTGATT CTGTCGCTACTGATTACGGT GCTGCTATCGATGGTTTCAT TGGTGACGTTTCCGGCCTTG CTAATGGTAATGGTGCTACT GGTGATTTTGCTGGCTCTAA TTCCCAAATGGCTCAAGTCG GTGACGGTGATAATTCACCT TTAATGAATAATTTCCGTCA ATATTTACCTTCCCTCCCTC AATCGGTTGAATGTCGCCCT TTTGTCTTTAGCGCTGGTAA ACCATATGAATTTTCTATTG ATTGTGACAAAATAAACTTA TTCCGTGGTGTCTTTGCGTT TCTTTTATATGTTGCCACCT TTATGTATGTATTTTCTACG TTTGCTAACATACTGCGTAA TAAGGAGTCTTAATCATGCC AGTTCTTTTGGGTATTCCGT TATTATTGCGTTTCCTCGGT TTCCTTCTGGTAACTTTGTT CGGCTATCTGCTTACTTTTC TTAAAAAGGGCTTCGGTAAG ATAGCTATTGCTATTTCATT GTTTCTTGCTCTTATTATTG GGCTTAACTCAATTCTTGTG GGTTATCTCTCTGATATTAG CGCTCAATTACCCTCTGACT TTGTTCAGGGTGTTCAGTTA ATTCTCCCGTCTAATGCGCT TCCCTGTTTTTATGTTATTC TCTCTGTAAAGGCTGCTATT TTCATTTTTGACGTTAAACA AAAAATCGTTTCTTATTTGG ATTGGGATAAATAATATGGC TGTTTATTTTGTAACTGGCA AATTAGGCTCTGGAAAGACG CTCGTTAGCGTTGGTAAGAT TCAGGATAAAATTGTAGCTG GGTGCAAAATAGCAACTAAT CTTGATTTAAGGCTTCAAAA CCTCCCGCAAGTCGGGAGGT TCGCTAAAACGCCTCGCGTT CTTAGAATACCGGATAAGCC TTCTATATCTGATTTGCTTG CTATTGGGCGCGGTAATGAT TCCTACGATGAAAATAAAAA CGGCTTGCTTGTTCTCGATG AGTGCGGTACTTGGTTTAAT ACCCGTTCTTGGAATGATAA GGAAAGACAGCCGATTATTG ATTGGTTTCTACATGCTCGT AAATTAGGATGGGATATTAT TTTTCTTGTTCAGGACTTAT CTATTGTTGATAAACAGGCG CGTTCTGCATTAGCTGAACA TGTTGTTTATTGTCGTCGTC TGGACAGAATTACTTTACCT TTTGTCGGTACTTTATATTC TCTTATTACTGGCTCGAAAA TGCCTCTGCCTAAATTACAT GTTGGCGTTGTTAAATATGG CGATTCTCAATTAAGCCCTA CTGTTGAGCGTTGGCTTTAT ACTGGTAAGAATTTGTATAA CGCATATGATACTAAACAGG CTTTTTCTAGTAATTATGAT TCCGGTGTTTATTCTTATTT AACGCCTTATTTATCACACG GTCGGTATTTCAAACCATTA AATTTAGGTCAGAAGATGAA ATTAACTAAAATATATTTGA AAAAGTTTTCTCGCGTTCTT TGTCTTGCGATTGGATTTGC ATCAGCATTTACATATAGTT ATATAACCCAACCTAAGCCG GAGGTTAAAAAGGTAGTCTC TCAGACCTATGATTTTGATA AATTCACTATTGACTCTTCT CAGCGTCTTAATCTAAGCTA TCGCTATGTTTTCAAGGATT CTAAGGGAAAATTAATTAAT AGCGACGATTTACAGAAGCA AGGTTATTCACTCACATATA TTGATTTATGTACTGTTTCC ATTAAAAAAGGTAATTCAAA TGAAATTGTTAAATGTAATT AATTTTGTTTTCTTGATGTT TGTTTCATCATCTTCTTTTG CTCAGGTAATTGAAATGAAT AATTCGCCTCTGCGCGATTT TGTAACTTGGTATTCAAAGC AATCAGGCGAATCCGTTATT GTTTCTCCCGATGTAAAAGG TACTGTTACTGTATATTCAT CTGACGTTAAACCTGAAAAT CTACGCAATTTCTTTATTTC TGTTTTACGTGCTAATAATT TTGATATGGTTGGTTCAATT CCTTCCATAATTCAGAAGTA TAATCCAAACAATCAGGATT ATATTGATGAATTGCCATCA TCTGATAATCAGGAATATGA TGATAATTCCGCTCCTTCTG GTGGTTTCTTTGTTCCGCAA AATGATAATGTTACTCAAAC TTTTAAAATTAATAACGTTC GGGCAAAGGATTTAATACGA GTTGTCGAATTGTTTGTAAA GTCTAATACTTCTAAATCCT CAAATGTATTATCTATTGAC GGCTCTAATCTATTAGTTGT TAGTGCACCTAAAGATATTT TAGATAACCTTCCTCAATTC CTTTCTACTGTTGATTTGCC AACTGACCAGATATTGATTG AGGGTTTGATATTTGAGGTT CAGCAAGGTGATGCTTTAGA TTTTTCATTTGCTGCTGGCT CTCAGCGTGGCACTGTTGCA GGCGGTGTTAATACTGACCG CCTCACCTCTGTTTTATCTT CTGCTGGTGGTTCGTTCGGT ATTTTTAATGGCGATGTTTT AGGGCTATCAGTTCGCGCAT TAAAGACTAATAGCCATTCA AAAATATTGTCTGTGCCACG TATTCTTACGCTTTCAGGTC AGAAGGGTTCTATCTCTGTT GGCCAGAATGTCCCTTTTAT TACTGGTCGTGTGACTGGTG AATCTGCCAATGTAAATAAT CCATTTCAGACGATTGAGCG TCAAAATGTAGGTATTTCCA TGAGCGTTTTTCCTGTTGCA ATGGCTGGCGGTAATATTGT TCTGGATATTACCAGCAAGG CCGATAGTTTGAGTTCTTCT ACTCAGGCAAGTGATGTTAT TACTAATCAAAGAAGTATTG CTACAACGGTTAATTTGCGT GATGGACAGACTCTTTTACT CGGTGGCCTCACTGATTATA AAAACACTTCTCAAGATTCT GGCGTACCGTTCCTGTCTAA AATCCCTTTAATCGGCCTCC TGTTTAGCTCCCGCTCTGAT TCCAACGAGGAAAGCACGTT ATACGTGCTCGTCAAAGCAA CCATAGTACGCGCCCTGTAG CGGCGCATTAAGCGCGGCGG GTGTGGTGGTTACGCGCAGC GTGACCGCTACACTTGCCAG CGCCCTAGCGCCCGCTCCTT TCGCTTTCTTCCCTTCCTTT CTCGCCACGTTCGCCGGCTT TCCCCGTCAAGCTCTAAATC GGGGGCTCCCTTTAGGGTTC CGATTTAGTGCTTTACGGCA CCTCGACCCCAAAAAACTTG ATTTGGGTGATGGTTCACGT AGTGGGCCATCGCCCTGATA GACGGTTTTTCGCCCTTTGA CGTTGGAGTCCACGTTCTTT AATAGTGGACTCTTGTTCCA AACTGGAACAACACTCAACC CTATCTCGGGACGGATCGCT TCATGTGGCAGGAGAAAAAA GGCTGCACCGGTGCGTCAGC AGAATATGTGATACAGGATA TATTCCGCTTCCTCGCTCAC TGACTCGCTACGCTCGGTCG TTCGACTGCGGCGAGCGGAA ATGGCTTACGAACGGGGCGG AGATTTCCTGGAAGATGCCA GGAAGATACTTAACAGGGAA GTGAGAGGGCCGCGGCAAAG CCGTTTTTCCATAGGCTCCG CCCCCCTGACAAGCATCACG AAATCTGACGCTCAAATCAG TGGTGGCGAAACCCGACAGG ACTATAAAGATACCAGGCGT TTCCCCCTGGCGGCTCCCTC GTGCGCTCTCCTGTTCCTGC CTTTCGGTTTACCGGTGTCA TTCCGCTGTTATGGCCGCGT TTGTCTCATTCCACGCCTGA CACTCAGTTCCGGGTAGGCA GTTCGCTCCAAGCTGGACTG TATGCACGAACCCCCCGTTC AGTCCGACCGCTGCGCCTTA TCCGGTAACTATCGTCTTGA GTCCAACCCGGAAAGACATG CAAAAGCACCACTGGCAGCA GCCACTGGTAATTGATTTAG AGGAGTTAGTCTTGAAGTCA TGCGCCGGTTAAGGCTAAAC TGAAAGGACAAGTTTTGGTG ACTGCGCTCCTCCAAGCCAG TTACCTCGGTTCAAAGAGTT GGTAGCTCAGAGAACCTTCG AAAAACCGCCCTGCAAGGCG GTTTTTTCGTTTTCAGAGCA AGAGATTACGCGCAGACCAA AACGATCTCAAGAAGATCAT CTTATTAAGGGGTCTGACGC TCAGTGGAACGAAAACTCAC GTTAAGGGATTTTGGTCATG AGATTATCAAAAAGGATCTT CACCTAGATCCTTTTAAATT AAAAATGAAGTTTTAAATCA ATCTAAAGTATATATGAGTA AACTTGGTCTGACAGTTACC AATGCTTAATCAGTGAGGCA CCTATCTCAGCGATCTGTCT ATTTCGTTCATCCATAGTTG CCTGACTCCCCGTCGTGTAG ATAACTACGATACGGGAGGG CTTACCATCTGGCCCCAGTG CTGCAATGATACCGCGAGAC CCACGCTCACCGGCTCCAGA TTTATCAGCAATAAACCAGC CAGCCGATTCGAGCTCGCCC CGGGGATCGACCAGTTGGTG ATTTTGAACTTTTGCTTTGC CACGGAACGGTCTGCGTTGT CGGGAAGATGCGTGATCTGA TCCTTCAACTCAGCAAAAGT TCGATTTATTCAACAAAGCC GCCGTCCCGTCAAGTCAGCG TAATGCTCTGCCAGTGTTAC AACCAATTAACCAATTCTGA TTAGAAAAACTCATCGAGCA TCAAATGAAACTGCAATTTA TTCATATCAGGATTATCAAT ACCATATTTTTGAAAAAGCC GTTTCTGTAATGAAGGAGAA AACTCACCGAGGCAGTTCCA TAGGATGGCAAGATCCTGGT ATCGGTCTGCGATTCCGACT CGTCCAACATCAATACAACC TATTAATTTCCCCTCGTCAA AAATAAGGTTATCAAGTGAG AAATCACCATGAGTGACGAC TGAATCCGGTGAGAATGGCA AAAGCTTATGCATTTCTTTC CAGACTTGTTCAACAGGCCA GCCATTACGCTCGTCATCAA AATCACTCGCATCAACCAAA CCGTTATTCATTCGTGATTG CGCCTGAGCGAGACGAAATA CGCGATCGCTGTTAAAAGGA CAATTACAAACAGGAATCGA ATGCAACCGGCGCAGGAACA CTGCCAGCGCATCAACAATA TTTTCACCTGAATCAGGATA TTCTTCTAATACCTGGAATG CTGTTTTCCCGGGGATCGCA GTGGTGAGTAACCATGCATC ATCAGGAGTACGGATAAAAT GCTTGATGGTCGGAAGAGGC ATAAATTCCGTCAGCCAGTT TAGTCTGACCATCTCATCTG TAACATCATTGGCAACGCTA CCTTTGCCATGTTTCAGAAA CAACTCTGGCGCATCGGGCT TCCCATACAATCGATAGATT GTCGCACCTGATTGCCCGAC ATTATCGCGAGCCCATTTAT ACCCATATAAATCAGCATCC ATGTTGGAATTTAATCGCGG CCTCGAGCAAGACGTTTCCC GTTGAATATGGCTCATAACA CCCCTTGTATTACTGTTTAT GTAAGCAGACAGTTTTATTG TTCATGATGATATATTTTTA TCTTGTGCAATGTAACATCA GAGATTTTGAGACACAACGT GGCTTTCCCCCCCCCCCCCT GCAGGTCTCGGGCTATTCTT TTGATTTATAAGGGATTTTG CCGATTTCGGCCTATTGGTT AAAAAATGAGCTGATTTAAC AAAAATTTAACGCGAATTTT AACAAAATATTAACGTTTAC AATTTAAATATTTGCTTATA CAATCTTCCTGTTTTTGGGG CTTTTCTGATTATCAACCGG GGTACATATGATTGACATGC TAGTTTTACGATTACCGTTC ATCGATTCTCTTGTTTGCTC CAGACTCTCAGGCAATGACC TGATAGCCTTTGTAGACCTC TCAAAAATAGCTACCCTCTC CGGCATGAATTTATCAGCTA GAACGGTTGAATATCATATT GATGGTGATTTGACTGTCTC CGGCCTTTCTCACCCTTTTG AATCTTTACCTACACATTAC TCAGGCATTGCATTTAAAAT ATATGAGGGTTCTAAAAATT TTTATCCTTGCGTTGAAATA AAGGCTTCTCCCGCAAAAGT ATTACAGGGTCATAATGTTT TTGGTACAACCGATTTAGCT TTATGCTCTGAGGCTTTATT GCTTAATTTTGCTAATTCTT TGCCTTGCCTGTATGATTTA TTGGATGTT

Data sets:
Data typeCount
13C chemical shifts238
15N chemical shifts53

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all