BMRB Entry 5167
Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5167
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Ulyanov, N.; Bauer, W.; James, T.. "High-resolution NMR Structure of an AT-rich DNA Sequence" J. Biomol. NMR 22, 265-280 (2002).
PubMed: 11991355
Assembly members:
GAA-Hairpin loop, polymer, 27 residues, Formula weight is not available
Natural source: Common Name: not available Taxonomy ID: not available Superkingdom: not available Kingdom: not available Genus/species: not available not available
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
GAA-Hairpin loop: CCTAATTATAACGAAGTTAT
AATTAGG
- assigned_chemical_shifts
| Data type | Count |
| 1H chemical shifts | 252 |
Additional metadata:
Assembly:
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | AT-Rich DNA with the GAA-Hairpin Loop | 1 |
Entities:
Entity 1, AT-Rich DNA with the GAA-Hairpin Loop 27 residues - Formula weight is not available
| 1 | DC | DC | DT | DA | DA | DT | DT | DA | DT | DA | ||||
| 2 | DA | DC | DG | DA | DA | DG | DT | DT | DA | DT | ||||
| 3 | DA | DA | DT | DT | DA | DG | DG |
Samples:
sample_1: GAA-Hairpin loop 2 mM; phosphate buffer 30 mM; EDTA 1 mM; H2O 90%; D2O 10%
sample_cond_1: ionic strength: 30 mM; pH: 8.0; pressure: 1 atm; temperature: 283 K
Experiments:
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D-NOESY | sample_1 | not available | sample_cond_1 |
| DQF-COSY | sample_1 | not available | sample_cond_1 |
| TOCSY | sample_1 | not available | sample_cond_1 |
Software:
VNMR v6.1 - collection
NMRPipe v1.8 - processing
SPARKY v3.1 - data analysis
MARDIGRAS v3.2 - iterative matrix relaxation
DYANA v1.5 - refinement
miniCarlo valpha version - refinement
NMR spectrometers:
- Varian INOVA 600 MHz