BMRB Entry 26568

Title:
The structure of the SOLE element of oskar mRNA   PubMed: 26089324
Deposition date:
2015-04-28
Original release date:
2015-05-04
Authors:
Simon, Bernd; Masiewicz, P.; Ephrussi, A.; Carlomagno, T.
Citation:

Citation: Simon, Bernd; Masiewicz, P.; Ephrussi, A.; Carlomagno, T.. "The structure of the SOLE element of oskar mRNA"  RNA 21, 1444-1453 (2015).

Assembly members:

Assembly members:
OSKAR_MRNA, polymer, 32 residues, 10376.25762 Da.

Natural source:

Natural source:   Common Name: fruit fly   Taxonomy ID: 7227   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Drosophila melanogaster

Experimental source:   Production method: recombinant technology   Host organism: in vitro transcription

Experimental source:

Natural source:   Common Name: fruit fly   Taxonomy ID: 7227   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Drosophila melanogaster

Experimental source:   Production method: recombinant technology   Host organism: in vitro transcription

Entity Sequences (FASTA):

Entity Sequences (FASTA):
OSKAR_MRNA: GACGAUAUCGAGCAUCAAGA GUGAAUAUCGUC

Data sets:
Data typeCount
13C chemical shifts213
15N chemical shifts38
1H chemical shifts251
31P chemical shifts30

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1OSKAR MRNA1

Entities:

Entity 1, OSKAR MRNA 32 residues - 10376.25762 Da.

1   GACGAUAUCG
2   AGCAUCAAGA
3   GUGAAUAUCG
4   UC

Samples:

sample_1: OSKAR MRNA, [U-13C; U-15N], 0.35 ± 0.05 mM

sample_conditions_1: ionic strength: 0.0 mM; pH: 6.400; pressure: 1 atm; temperature: 308.000 K

Experiments:

NameSampleSample stateSample conditions
HBCNB/HSCNBsample_1solutionsample_conditions_1
HCCH-COSY-TOCSYsample_1solutionsample_conditions_1
3D EDITED NOESYsample_1solutionsample_conditions_1
HBCNB/HSCNBsample_1solutionsample_conditions_1
HCCH-COSY-TOCSYsample_1solutionsample_conditions_1
3D 13C EDITED NOESYsample_1solutionsample_conditions_1
2D NOESYsample_1solutionsample_conditions_1
2D HNN-COSYsample_1solutionsample_conditions_1

Software:

AutoDep v4.3, PDBe - chemical shift assignment

CNS v1.1, Brunger, Adams, Clore, Gros, Nilges and Read - chemical shift assignment

FELIX vany, Accelrys Software Inc. - chemical shift assignment

NMR spectrometers:

  • Bruker Avance 600 MHz
  • Bruker Avance 800 MHz

Related Database Links:

UNP P25158
PDB