Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34835
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Vianney, Y.; Schroder, N.; Jana, J.; Chojetzki, G.; Weisz, K.. "Showcasing Different G-Quadruplex Folds of a G-Rich Sequence: Between Rule-Based Prediction and Butterfly Effect." J. Am. Chem. Soc. 145, 22194-22205 (2023).
PubMed: 37751488
Assembly members:
entity_1, polymer, 22 residues, 6995.475 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGTAGGGCGGCGGGGCAGG
GT
Data type | Count |
13C chemical shifts | 39 |
1H chemical shifts | 150 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | unit_1 | 1 |
Entity 1, unit_1 22 residues - 6995.475 Da.
1 | DG | DG | DG | DT | DA | DG | DG | DG | DC | DG | ||||
2 | DG | DC | DG | DG | DG | DG | DC | DA | DG | DG | ||||
3 | DG | DT |
sample_1: DNA 1 mM
sample_conditions_1: ionic strength: 10 mM; pH: 7.0; pressure: 1 atm; temperature: 303 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-15N HSQC | sample_1 | isotropic | sample_conditions_1 |
2D DQF-COSY | sample_1 | isotropic | sample_conditions_1 |
CcpNmr Analysis v2.4.2, CCPN - chemical shift assignment
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation
TopSpin v4.0.7, Bruker Biospin - data analysis