Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34654
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Borggrafe, Jan; Victor, Julian; Rosenbach, Hannah; Viegas, Aldino; Gertzen, Christoph; Wuebben, Christine; Kovacs, Helena; Gopalswamy, Mohanraj; Riesner, Detlev; Steger, Gerhard; Schiemann, Olav; Gohlke, Holger; Span, Ingrid; Etzkorn, Manuel. "Time-resolved structural analysis of an RNA-cleaving DNA catalyst
" Nature 601, 144-149 (2022).
PubMed: 34949858
Assembly members:
entity_1, polymer, 33 residues, 10266.592 Da.
entity_2, polymer, 19 residues, 5980.640 Da.
Natural source: Common Name: not available Taxonomy ID: 32630 Superkingdom: not available Kingdom: not available Genus/species: synthetic construct
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTGGGGTAAGGCTCGCTACA
ACGAGGTGCATGT
entity_2: ACAUGCACCGUUACCCCAA
| Data type | Count |
| 13C chemical shifts | 118 |
| 15N chemical shifts | 6 |
| 1H chemical shifts | 423 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | unit_1 | 1 |
| 2 | unit_2 | 2 |
Entity 1, unit_1 33 residues - 10266.592 Da.
| 1 | DT | DT | DG | DG | DG | DG | DT | DA | DA | DG | ||||
| 2 | DG | DC | DT | DC | DG | DC | DT | DA | DC | DA | ||||
| 3 | DA | DC | DG | DA | DG | DG | DT | DG | DC | DA | ||||
| 4 | DT | DG | DT |
Entity 2, unit_2 19 residues - 5980.640 Da.
| 1 | A | C | A | U | G | C | A | C | C | G | ||||
| 2 | U | U | A | C | C | C | C | A | A |
sample_1: 110-23 DNAzyme (33-MER) 500 uM; RNA target (19-MER) 500 uM; Tris-d11 50 mM; NaCl 100 mM; MgCl2 1 mM
sample_2: 110-23 DNAzyme (33-MER) 750 uM; RNA target (19-MER) 750 uM; Tris-d11 50 mM; NaCl 100 mM; MgCl2 1 mM
sample_3: 110-23 DNAzyme (33-MER), [U-13C; U-15N], 500 uM; RNA target (19-MER) 500 uM; Tris-d11 50 mM; NaCl 100 mM; MgCl2 1 mM
sample_conditions_1: ionic strength: 133 mM; pH: 7.5; pressure: 1 atm; temperature: 310.12 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aliphatic | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC-TOCSY | sample_3 | isotropic | sample_conditions_1 |
| 3D 1H-13C NOESY aliphatic | sample_3 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_2 | anisotropic | sample_conditions_1 |
| 2D 1H-1H TOCSY | sample_2 | isotropic | sample_conditions_1 |
TopSpin v4.0.6, Bruker Biospin - collection
CARA v1.9.1.5, Keller and Wuthrich - chemical shift assignment, peak picking
Sparky v3.114, Goddard - peak picking
X-PLOR NIH v2.49, Schwieters, Kuszewski, Tjandra and Clore - structure calculation