Click here to enlarge.
PDB ID: 6gh0
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34269
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Kotar, A.; Rigo, R.; Sissi, C.; Plavec, J.. "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure." Nucleic Acids Res. 47, 2641-2653 (2019).
PubMed: 30590801
Assembly members:
entity_1, polymer, 22 residues, 6940.439 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGCGAGGAGGGGCGTGGCCG
GC
Data type | Count |
1H chemical shifts | 193 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 22 residues - 6940.439 Da.
1 | DG | DG | DC | DG | DA | DG | DG | DA | DG | DG | ||||
2 | DG | DG | DC | DG | DT | DG | DG | DC | DC | DG | ||||
3 | DG | DC |