BMRB Entry 5632

Name: Solution structure of the p2b hairpin from human telomerase RNA
Published: 2004-03-07

Click here to enlarge.

PDB ID: 1na2
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5632
MolProbity Validation Chart

NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry

Nicholas Rego and David Koes
3Dmol.js: molecular visualization with WebGL
Bioinformatics (2015) 31 (8): 1322-1324 doi:10.1093/bioinformatics/btu829

Select model:

I am color blind

Download raw data. Direct link to this display. Help

Title:

Solution structure of the p2b hairpin from human telomerase RNA

Deposition date:

2002-12-19

Original release date:

2004-03-07

Authors:

Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.

Citation:

Citation: Theimer, C.; Finger, L.; Trantirek, L.; Feigon, J.. "Mutations Linked to Dyskeratosis congenita Cause Changes in the Structural Equilibrium in Telomerase RNA" Proc. Natl. Acad. Sci. U. S. A. 100, 449-454 (2003).
PubMed: 12525685

Assembly members:

Assembly members:
human telomerase RNA, polymer, 30 residues, 9900 Da.

Natural source:

Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens

Experimental source:

Experimental source: Production method: enzymatic semisynthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
human telomerase RNA: GGGCUGUUUUUCUCGCUGAC UUUCAGCCCC

Data sets:

assigned_chemical_shifts
- chemical_shift_set_1

Data type	Count
13C chemical shifts	201
15N chemical shifts	25
1H chemical shifts	262

Additional metadata:

Assembly
Samples and Experiments
Software
Spectrometers
Hide all

Assembly:

Entity Assembly ID	Entity Name	Entity ID
1	telomerase RNA p2b hairpin	1

Entities:

Entity 1, telomerase RNA p2b hairpin 30 residues - 9900 Da.

1	G	G	G	C	U	G	U	U	U	U
2	U	C	U	C	G	C	U	G	A	C
3	U	U	U	C	A	G	C	C	C	C

Samples:

sample_1: human telomerase RNA 1 mM; Na phosphate 10 mM; KCl 200 mM; NaN3 0.2%; EDTA 50 uM; H2O 95%; D2O 5%

sample_2: human telomerase RNA, [U-100% 13C; U-100% 15N], 1 mM; Na phosphate 10 mM; KCl 200 mM; NaN3 0.2%; EDTA 50 uM; H2O 95%; D2O 100%

sample_3: human telomerase RNA, [U-100% 13C; U-100% 15N], 1 mM

sample_cond_1: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 278 K

sample_cond_2: ionic strength: 200 mM; pH: 6.3; pressure: 1 atm; temperature: 293 K

Experiments:

Name	Sample	Sample state	Sample conditions
2D NOESY	not available	not available	not available
DQF-COSY	not available	not available	not available
3D 13C-separated NOESY	not available	not available	not available
3D 13C NOESY-HMQC	not available	not available	not available

Software:

xwinnmr v2.6 - processing

AURELIA v3.108 - data analysis

X-PLOR v3.851 - refinement, structure solution

NMR spectrometers:

Bruker DRX 500 MHz