Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34435
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Plavec, J.; Kocman, V.; Kotar, A.. "Intercalation of heterocyclic ligand between quartets in G-rich tetrahelical structure.
" Chemistry 6, 814-817 (2019).
PubMed: 31750579
Assembly members:
entity_1, polymer, 31 residues, 9888.333 Da.
entity_LWQ, non-polymer, 449.504 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: GGGAGCGAGGGAGCGAGGGA
GCGAGGGAGCG
| Data type | Count |
| 1H chemical shifts | 235 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | entity_1 | 1 |
| 2 | entity_2 | 2 |
Entity 1, entity_1 31 residues - 9888.333 Da.
| 1 | DG | DG | DG | DA | DG | DC | DG | DA | DG | DG | ||||
| 2 | DG | DA | DG | DC | DG | DA | DG | DG | DG | DA | ||||
| 3 | DG | DC | DG | DA | DG | DG | DG | DA | DG | DC | ||||
| 4 | DG |
Entity 2, entity_2 - C27 H23 N5 O2 - 449.504 Da.
| 1 | LWQ |
sample_1: VK2 0.35 mM; LiCl 100 mM
sample_2: VK2, 10% Residue-specific labrelling, 0.35 mM; LiCl 100 mM
sample_conditions_1: ionic strength: 100 mM; pH: 6.0; pressure: 1 atm; temperature: 273 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-13C HSQC aromatic | sample_1 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
| 2D 1H-15N HSQC | sample_2 | isotropic | sample_conditions_1 |
VNMR, Varian - chemical shift assignment, collection, processing
Sparky, Goddard - data analysis
Amber v18, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - refinement, structure calculation