Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR5321
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Sakamoto, T.; Morita, S.; Tabata, K.; Nakamura, K.; Kawai, G.. "Solution Structure of a SRP19 Binding Domain in Human SRP RNA" J. Biochem. (Tokyo) 132, 177-182 (2002).
PubMed: 12153712
Assembly members:
helix 6 of signal recognition particle RNA, polymer, 29 residues, Formula weight is not available
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: enzymatic semisynthesis
Entity Sequences (FASTA):
helix 6 of signal recognition particle RNA: GGUGACCUCCCGGGAGCGGG
GGACCACCA
| Data type | Count |
| 1H chemical shifts | 164 |
| Entity Assembly ID | Entity Name | Entity ID |
|---|---|---|
| 1 | helix 6 of SRP RNA | 1 |
Entity 1, helix 6 of SRP RNA 29 residues - Formula weight is not available
| 1 | G | G | U | G | A | C | C | U | C | C | ||||
| 2 | C | G | G | G | A | G | C | G | G | G | ||||
| 3 | G | G | A | C | C | A | C | C | A |
sample_1: helix 6 of signal recognition particle RNA 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM
sample_2: helix 6 of signal recognition particle RNA, [U-15N; U-13C]-Guanosine,Uridine, 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM
sample_3: helix 6 of signal recognition particle RNA, [U-15N; U-13C]-Adenosine,Cytidine, 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM
sample_4: helix 6 of signal recognition particle RNA, [U-15N; U-13C]-Guanosine,Cytidine, 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM
sample_cond_1: ionic strength: 70 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K
| Name | Sample | Sample state | Sample conditions |
|---|---|---|---|
| 2D NOESY | not available | not available | not available |
| 2D HNN-COSY | not available | not available | not available |
| 2D half filtered NOESY | not available | not available | not available |
| DQF-COSY | not available | not available | not available |
| 2D HP-COSY | not available | not available | not available |
| 2D TOCSY | not available | not available | not available |
| 2D HCCH-COSY | not available | not available | not available |
| 2D HCCH-TOCSY | not available | not available | not available |
xwinnmr v2.1 - collection
VNMR v6.1B - collection
FELIX v97.0 - data analysis
DISCOVER v97.0 - refinement, structure solution