BMRB Entry 5321

Title:
NMR structure of a SRP19 binding domain in human SRP RNA
Deposition date:
2002-03-14
Original release date:
2002-05-20
Authors:
Sakamoto, T.; Morita, S.; Tabata, K.; Nakamura, K.; Kawai, G.
Citation:

Citation: Sakamoto, T.; Morita, S.; Tabata, K.; Nakamura, K.; Kawai, G.. "Solution Structure of a SRP19 Binding Domain in Human SRP RNA"  J. Biochem. (Tokyo) 132, 177-182 (2002).
PubMed: 12153712

Assembly members:

Assembly members:
helix 6 of signal recognition particle RNA, polymer, 29 residues, Formula weight is not available

Natural source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:

Experimental source:   Production method: enzymatic semisynthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
helix 6 of signal recognition particle RNA: GGUGACCUCCCGGGAGCGGG GGACCACCA

Data sets:
Data typeCount
1H chemical shifts164

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1helix 6 of SRP RNA1

Entities:

Entity 1, helix 6 of SRP RNA 29 residues - Formula weight is not available

1   GGUGACCUCC
2   CGGGAGCGGG
3   GGACCACCA

Samples:

sample_1: helix 6 of signal recognition particle RNA 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM

sample_2: helix 6 of signal recognition particle RNA, [U-15N; U-13C]-Guanosine,Uridine, 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM

sample_3: helix 6 of signal recognition particle RNA, [U-15N; U-13C]-Adenosine,Cytidine, 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM

sample_4: helix 6 of signal recognition particle RNA, [U-15N; U-13C]-Guanosine,Cytidine, 0.5 mM; sodium phosphate 20 mM; NaCl 50 mM

sample_cond_1: ionic strength: 70 mM; pH: 6.5; pressure: 1 atm; temperature: 298 K

Experiments:

NameSampleSample stateSample conditions
2D NOESYnot availablenot availablenot available
2D HNN-COSYnot availablenot availablenot available
2D half filtered NOESYnot availablenot availablenot available
DQF-COSYnot availablenot availablenot available
2D HP-COSYnot availablenot availablenot available
2D TOCSYnot availablenot availablenot available
2D HCCH-COSYnot availablenot availablenot available
2D HCCH-TOCSYnot availablenot availablenot available

Software:

xwinnmr v2.1 - collection

VNMR v6.1B - collection

FELIX v97.0 - data analysis

DISCOVER v97.0 - refinement, structure solution

NMR spectrometers:

  • Bruker DRX 600 MHz
  • Varian UnityPlus 800 MHz