Click here to enlarge.
PDB ID:
Entry in NMR Restraints Grid
Validation report in NRG-CING
Chem Shift validation: AVS_full
BMRB Entry DOI: doi:10.13018/BMR34332
MolProbity Validation Chart
NMR-STAR file interactive viewer.
NMR-STAR v3 text file.
XML gzip file.
RDF gzip file.
All files associated with the entry
Citation: Bielskute, S.; Plavec, J.; Podbevsek, P.. "Impact of Oxidative Lesions on the Human Telomeric G-quadruplex" J. Am. Chem. Soc. 141, 2594-2603 (2019).
PubMed: 30657306
Assembly members:
entity_1, polymer, 24 residues, 7607.883 Da.
Natural source: Common Name: Human Taxonomy ID: 9606 Superkingdom: Eukaryota Kingdom: Metazoa Genus/species: Homo sapiens
Experimental source: Production method: chemical synthesis
Entity Sequences (FASTA):
entity_1: TTGGGTTAGGGTTAGGGTTA
XGGA
Data type | Count |
1H chemical shifts | 157 |
Entity Assembly ID | Entity Name | Entity ID |
---|---|---|
1 | entity_1 | 1 |
Entity 1, entity_1 24 residues - 7607.883 Da.
1 | DT | DT | DG | DG | DG | DT | DT | DA | DG | DG | ||||
2 | DG | DT | DT | DA | DG | DG | DG | DT | DT | DA | ||||
3 | 8OG | DG | DG | DA |
sample_1: DNA 1 ± 0.2 mM; potassium phosphate buffer 20 mM; KCl 70 mM
sample_conditions_1: ionic strength: 70 mM; pH: 7; pressure: 1 atm; temperature: 298 K
Name | Sample | Sample state | Sample conditions |
---|---|---|---|
2D 1H-1H NOESY | sample_1 | isotropic | sample_conditions_1 |
2D 1H-1H TOCSY | sample_1 | isotropic | sample_conditions_1 |
CcpNMR, CCPN - chemical shift assignment
NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing
AMBER, Case, Darden, Cheatham III, Simmerling, Wang, Duke, Luo, ... and Kollman - structure calculation