BMRB Entry 30533

Title:
Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation
Deposition date:
2018-10-31
Original release date:
2020-05-04
Authors:
Walker, M.; Shortridge, M.; Varani, G.
Citation:

Citation: Walker, M.; Shortridge, M.; Albin, D.; Cominsky, L.; Varani, G.. "Solution structure of a c-JUN 5' UTR stem-loop associated with specialized cap-dependent translation initiation"  .

Assembly members:

Assembly members:
entity_1, polymer, 49 residues, 15523.181 Da.

Natural source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Experimental source:

Natural source:   Common Name: Human   Taxonomy ID: 9606   Superkingdom: Eukaryota   Kingdom: Metazoa   Genus/species: Homo sapiens

Experimental source:   Production method: chemical synthesis

Entity Sequences (FASTA):

Entity Sequences (FASTA):
entity_1: GGCAGUAUAGUCCGAACUGC AACUUCGGUUCACCUUCUCU CUAACUGCC

Data sets:
Data typeCount
13C chemical shifts332
15N chemical shifts14
1H chemical shifts419

Additional metadata:

  • Assembly
  • Samples and Experiments
  • Software
  • Spectrometers
  • Hide all

Assembly:

Entity Assembly IDEntity NameEntity ID
1entity_11

Entities:

Entity 1, entity_1 49 residues - 15523.181 Da.

1   GGCAGUAUAG
2   UCCGAACUGC
3   AACUUCGGUU
4   CACCUUCUCU
5   CUAACUGCC

Samples:

sample_1: RNA 1.0 mM; Sodium Phosphate 20 mM

sample_2: RNA 1.0 mM; Sodium Phosphate 20 mM

sample_3: RNA, [A,G-98% D3',4',5',5"; C,U-98%: D3',4',5, 5',5"], 1.0 mM; Sodium Phosphate 20 mM

sample_4: RNA, [A,C,G,U-98% 13C, A,C,G,U-98% 15N], 1.0 mM; Sodium Phosphate 20 mM

sample_5: RNA, [A,C,G,U-98% 13C, A,C,G,U-98% 15N], 1.0 mM; Sodium Phosphate 20 mM

sample_conditions_1: ionic strength: 20 mM; pH: 6.1; pressure: 1 atm; temperature: 298 K

sample_conditions_2: ionic strength: 20 mM; pH: 6.1; pressure: 1 atm; temperature: 278 K

Experiments:

NameSampleSample stateSample conditions
2D 1H-1H NOESYsample_1isotropicsample_conditions_1
2D 1H-1H NOESYsample_2isotropicsample_conditions_2
2D 1H-1H NOESYsample_3isotropicsample_conditions_1
3D 1H-13C NOESYsample_4isotropicsample_conditions_1
2D 1H-15N HSQCsample_5isotropicsample_conditions_2
2D 1H-13C HSQCsample_4isotropicsample_conditions_1
2D 1H-1H TOCSYsample_1isotropicsample_conditions_1

Software:

TOPSPIN, Bruker Biospin - collection

NMRPipe, Delaglio, Grzesiek, Vuister, Zhu, Pfeifer and Bax - processing

SPARKY, Goddard - peak picking

CcpNMR, CCPN - peak picking

X-PLOR NIH, Schwieters, Kuszewski, Tjandra and Clore - refinement, structure calculation

NMR spectrometers:

  • Bruker AvanceIII 800 MHz
  • Bruker AvanceII 600 MHz